• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention relates to a method of treating spinal cord injury using an α d monoclonal antibody.
    公开号:KR20030044001A
    申请号:KR10-2003-7005246
    申请日:2001-10-15
    公开日:2003-06-02
    发明作者:갈라틴더블유마이클；반더비렌모니카
    申请人:이코스 코포레이션；
    IPC主号:
    专利说明:

    New human β2 integrin alpha subunit {NOVEL HUMAN β2 INTEGRIN ALPHA SUBUNIT}
    [1] This application is issued to U.S. Patent No. 5,437,958, filed Aug. 1, 1995, and U.S. Patent No. 5,470,953, issued November 28, 1995, which is part of US Application No. 08 / 173,497, filed Dec. 23, 1993. Part of US Application No. 08 / 286,889, filed August 5, 1994, US Patent No. 08 / 362,652, filed December 21, 1994, US Patent No. 5,766,850, issued June 16, 1998 Part of Continuing Application of U.S. Patent No. 08 / 605,672, filed Feb. 22, 1996, U.S. Patent No. 5,817,515, filed Oct. 6, 1998, filed on Oct. 3, 1997, pending. United States Patent Application No. 08 / 943,363, filed July 8, 1999, filed on September 16, 1998, which is part of US Patent Application No. 09 / 193,043, filed on November 16, 1998 Patent Part of the application on application number 09 / 350,259. These applications are incorporated herein by reference.
    [2] Background of the Invention
    [3] Integrins are a type of membrane-related molecule that actively participates in cell adhesion. Integrins are dural heterodimers containing α subunits that have a non-covalent relationship with β subunits. To date, at least 14 α subunits and 8 β subunits have been identified. Springer, Nature 346: 425-434 (1990). β subunits may generally be associated with more than one α subunit, and heterodimers that share a common β subunit have been classified as subfamily within the integrin population.
    [4] One class of human integrins, limited to expressing in white blood cells, is characterized by a common β 2 subunit. Because of this cell specific expression, these integrins are referred to as leukocyte integrins, Leu-CAM or leucointegrins. Another indication of this type due to the common β 2 subunit is β 2 integrins. β 2 subunit (CD18) has previously been isolated in association with one of three unique α subunits, CD11a, CD11b or CD11c. Isolation of cDNA encoding human CD18 is described in Kishimoto, et al., Cell 48: 681-690 (1987). In official WHO nomenclature, heterodimeric proteins are referred to as CD11a / CD18, CD11b / CD18 and CD11c / CD18; In conventional nomenclature, LFA-1, Mac-1 or Mol and p150,95 or LeuM5, respectively. Cobbold, et al., Leukocyte Typing III , McMichael (ed), Oxford Press, p. 788 (1987). Human β 2 integrin α subunits CD11a, CD11b and CD11c have been demonstrated to migrate under reducing conditions in electrophoresis with apparent molecular weights of about 180 kD, 155 kD and 150 kD, respectively, and the DNA encoding these subunits is cloned It was. See CD11a, Larson, et al., J. Cell Biol. 108 : 703-712 (1989); CD11b, Corbi, et al., J. Biol. Chem. 263 : 12403-12411 (1988) and CD11c, Corbi, et al. EMBO J. 6 : 4023-4028 (1987)]. The tentative homologues of human β 2 integrin α and β chains are defined by approximate similarities in molecular weight, which are monkeys and other primates (Letvin, et al., Blood 61 : 408-410 (1983)), Mice: Sanchez-Madrid, et al., J. Exp. Med. 154 : 1517 (1981) and dogs, Moore, et al., Tissue Antigens 36 : 211-220 (1990).
    [5] Absolute molecular weights of hypothesized homologues from other species have been shown to change significantly. (E.g. Danilenko et al., Tissue Antigens 40 : 13-21 (1992)), and in the absence of sequence information, no positive correlation was possible between human integrin subunits and subunits identified in other species. . In addition, changes in the number of members in the protein family were observed between different species. For example, assume that more IgA isoforms are isolated from rabbits than humans. Burnett, et al., EMBO J. 8 : 4041-4047 (1989) and Schneiderman, et al., Proc. Natl. Acad. Sci. (USA) 86 : 7561-7565 (1989). Similarly, in humans, six or more regulatory factors of metallothionine proteins have been previously identified, but Karin and Richards, Nature 299 : 797-802 (1982) and Varshney, et al., Mol. Cell. Biol. 6 : 26-37, (1986)], on the other hand, only two of these regulatory factors were demonstrated in mice. Searle, et al., Mol. Cell. Viol. 4 : 1221-1230 (1984). Therefore, the presence of multiple members of a family of proteins in one species does not necessarily include that the family of members exists in another species.
    [6] In the specific relationship of β 2 integrins in dogs, the hypothesized dog β 2 counterpart to human CD18 may form dimers with as many as four potentially distinct α subunits. Danilenko, et al., Homology. Antibodies produced by immunizing mice with splenocytes of a dog are monoclonal which are temporarily identified as dog homologues for human CD18, CD11a, CD11b and CD11c based on molecular weights of which immunoprecipitated proteins are predominantly similar but not identical. Generate ronal antibodies. Another anti-canine splenocyte antibody, Ca11.8H2, is recognized and may be associated with the β 2 subunit, but has a unique molecular weight and is limited to the expression of a differentiated subset of differentiated tissue macrophages. Immunoprecipitate subunits of the dog.
    [7] Two anti-integrin antibodies are produced by antibodies produced by immunizing hamsters with mouse branched cells. Metlay, et al., J. Exp. Med. 171 : 1753-1771 (1990). One antibody, 2E6, immunoprecipitates a major heterodimer with subunits with approximate molecular weights of 180 kD and 90 kD, in addition to a few bands with molecular weights of 150-160 kD. The second antibody, N418, precipitates another distinct heterodimer with subunits of approximately 150 kD and 90 KD in molecular weight. Based on intracellular adhesion blocking studies, it can be hypothesized that antibody 2E6 is a mouse counterpart to human CD18. The molecular weight of the N418 antigen suggests recognition of the mouse homologs to human CD11c / CD18, and further analysis shows that the mouse antigen exhibits a tissue distribution pattern that is inconsistent with that observed for human CD11c / CD18. Able to know.
    [8] The antigen is recognized by a Ca11.8H2 antibody in a dog, and the murine N418 antibody may represent a regulatory factor species (eg, glycosylation or splice regulatory factor) of the α subunit of the dog or rat previously identified. In addition, these antigens may represent unique dog and mouse integrin α subunits. If there is no specificity information for the primary structure, these variants are not distinguished.
    [9] In humans, CD11a / CD18 is transduced in all white blood cells. CD11b / CD18 and CD 11c / CD18 are limited to expression in monocytes, granulocytes, macrophages, and natural killer (NK) cells in a heterogeneous manner, but CD11c / CD18 is also detected on certain B-cell types. In general, CD11a / CD18 predominates in lymphocytes, CD11b / CD18 predominates in granulocytes, and CD11c / CD18 predominates in macrophages. Arnaout, Blood 75 : 1037-1050 (1990). However, expression of the α chain is variable depending on the state of activation and differentiation of each cell type. Larson and Springer, Immunol. Rev. 114 : 181-217 (1990).
    [10] The development of β 2 integrins in human immune and inflammatory responses has been exemplified using monoclonal antibodies capable of blocking β 2 integrin related cell adhesion. For example, CD11a / CD18, CD11b / CD18 and CD11c / CD18 are lymphoma and adenocarcinoma cells. Patarroyo, et al., Immunol. Rev. 114: 67-108 (1990)], granulocyte accumulation [Nourshargh, et al., J. Immunol. 142 : 3193-3198 (1989)], granulocyte-independent plasma efflux [Arfors, et al., Blood 69 : 338-340 (1987)], chemotactic response of stimulated leukocytes [Arfors, et al. ., Homology] and leukocyte adhesion to vascular endothelium [Price, et al., J. Immunol. 139 : 4174-4177 (1987) and Smith, et al., J. Clin. Invest. 83 : 2008-2017 (1989)] and actively participates in natural killer (NK) cells that bind. The basic role of β 2 integrins in immune and inflammatory responses is evident in a clinical syndrome called leukocyte adhesion deficiency (LAD), where the clinical signs are recurrent and mainly life-threatening bacterial infections. LAD is generated from heterogeneous mutations in the β 2 subunit and Kishimoto, et al., Cell 50 : 193-202 (1987), and the severity of the disease state is proportional to the deficiency in β 2 subunit expression. do. Formation of fully integrin heterodimers is impaired by β 2 mutations. Kishimoto, et al., Homology. Interestingly, one or more antibodies with specificity for CD18 have been shown to inhibit human immunodeficiency virus-1 (HIV-1) complex formation in vitro, although the exact mechanism of this inhibition is not apparent. Hildreth and Orentas, Science 244 : 1075-1078 (1989). This observation is consistent with the finding that ICAM-1, the major reverse receptor for CD11a / CD18, is a surface receptor for the main group of rhinovirus serotypes. Greve, et al., Cell 56 : 839 (1989).
    [11] The significance of β 2 integrin binding activity in human immune and inflammatory responses highlights the need for a more complete understanding of this surface protein type. Yet, as well as a member of this subfamily of the unknown, identification and production of monoclonal antibodies with other soluble factors or monoclonal of which can change the biological activity of the β 2 integrin for its reverse receptor therapy in β 2 integrin-related immune and inflammatory responses Provide practical means for enemy intervention.
    [12] Brief description of the invention
    [13] In one embodiment, the present invention relates to novel human β 2 integrin α subunit, α d and its regulatory elements (i. E., Deletion, addition or substitution analogs) with a binding and / or immunological properties inherent to α d encrypting To provide new purified and isolated polynucleotides (eg, DNA and RNA transcripts, both sensory and anti-sensory strands). Preferred DNA molecules of the invention include cDNA, genomic DNA and fully or partially chemically synthesized DNA molecules and the like. Currently preferred polynucleotides are DNA as set forth in SEQ ID NO: 1, encoding the polypeptide of SEQ ID NO: 2. Also provided are recombinant plasmids comprising the α d coding sequence and viral DNA constructs (transgenic constructs), wherein the α d coding sequence is operably linked to homologous or heterologous transcriptional regulatory element (s).
    [14] The present invention also provides isolated and purified mouse and rat polynucleotides that show homology to polynucleotides encoding human α d . Preferred mouse polynucleotides are shown in SEQ ID NO: 52 and preferred rat polynucleotides are shown in SEQ ID NO: 54.
    [15] In another embodiment of the invention there is provided a prokaryotic or eukaryotic host cell transformed or transfected with a DNA sequence of the invention which expresses an α d polypeptide or a regulatory factor thereof. The host cell of the present invention is very useful for large scale production of α d polypeptides that can be isolated from the host cell itself or from the medium in which the host cell is propagated. Host cells that express α d polypeptides on their extracellular membrane surface are useful as immunogens in the production of α d -specific antibodies. Host cells infected with α d are co-infected to express β 2 integrin subunits to surface express heterodimers.
    [16] In addition, the present invention provides purified and isolated α d polypeptides, fragments and regulatory factors thereof. Preferred α d polypeptides are shown in SEQ ID NO: 2. The novel α d products of the invention can be obtained as isolates from natural sources, but are preferably produced by recombinant techniques, including the host cells of the invention, in combination with the α d regulatory factor products. Fully glycosylated, partially glycosylated and total deglycosylated forms of the α d polypeptides can be produced by altering host cells selected for recombinant production and / or post-separation treatment. Regulatory Factor α d polypeptides of the present invention may comprise one or more biologically active or immunological properties in which at least one amino acid is specific for α d in the absence of (1) a deletion and preferably in the presence of an enhancement, or (2) a specific ligand / Water soluble and water insoluble α d polypeptides, including analogs that are deleted or substituted by specific neutralization of receptor binding or signal function. Also provided are fusion polypeptides in which the α d amino acid sequence is adjacently expressed using amino acid sequences from other polypeptides. Such fusion polypeptides may have modified biological, biochemical and / or immunological properties relative to wild type α d . There are analogous polypeptides that include additional amino acid (eg lysine or cysteine) residues that promote multimer formation.
    [17] In addition, according to the present invention, there are polypeptides and other non-peptide molecules that specifically bind α d . Examples of preferred binding molecules include antibodies (eg, monoclonal and polyclonal antibodies), reverse receptors (eg, membranes) including competitive binding of α d in the presence of α d monoclonal antibodies and / or specific reverse receptors. Related and soluble forms) and other ligands (eg, natural or synthetic molecules). Binding of molecules is useful for purification of α d polypeptides and for identification of cell types that express α d . In addition, binding of molecules is useful for in vivo binding and / or modifying (ie, inhibiting, blocking or stimulating) the signal transduction activity of α d .
    [18] Also provided are assays that identify α d binding molecules, including in vitro assays such as immobilized ligand binding assays, solution binding assays, and scintillation proximity assays, as well as cell line assays such as di-hybrid screening assays, cleavage hybrid screening assays, and the like. . Cell line analysis provides phenotypic changes in host cells as a result of specific binding interactions or disruption of specific binding interactions, allowing indirect quantification or measurement of specific specific binding interactions.
    [19] In vitro assays to identify other compounds or antibodies that modulate the activity of α d may, for example, immobilize natural ligands that bind α d or α d , detectably label the un immobilized binding partners, and bind Incubating the partners together and measuring the effect of the test compound on the amount of binding of the label, wherein a decrease in the amount of binding of the label in the presence of the test compound on the amount of binding of the label in the absence of the test compound Is an inhibitor of α d binding.
    [20] Another type of in vitro assay for identifying compounds that modulate the interaction between a d and ligand is immobilization of a d or a fragment thereof on a solid support coated (or impregnated) with a fluorescent agent, and Labeling the ligand with a compound capable of excitation, contacting the immobilized α d with the labeled ligand in the presence and absence of a potential regulatory factor compound, detecting light emission by a fluorescent agent, and fluorescence in the absence of the regulatory compound And to modify the compound as a compound that affects the emission of light by the fluorescent agent relative to the emission of light by the agent. Alternatively, the α d ligand can be immobilized and the α d can be labeled in this assay.
    [21] Cell line analysis methods contemplated by the present invention for identifying compounds that modulate the interaction between a d and a ligand include a DNA comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an active domain. Constitutively transforming or transfecting the appropriate host cell and transducing within the host cell a primary hybrid DNA sequence encoding a primary fusion of all or part of α d with an active domain of a DNA binding domain or transcription factor. Expresses in a host cell a secondary hybrid DNA sequence that encodes part or all of a ligand and a DNA binding domain, or activates a domain of a transcription factor that is not included in the primary fusion, To measure the production of reporter gene products in host cells in the presence or absence Thereby assessing the effect of a potential modification of the compound on the interaction between α d and the ligand, in particular by detecting the binding of the ligand to α d in a host cell, and reporting the gene product on the generation of the reporter gene product in the absence of regulatory compounds. To modify the compound as a compound that alters the production of Preferred for use in such assays include the lexA promoter, lexA DNA binding domain, GAL4 transactivation domain, lacZ reporter gene and yeast host cell.
    [22] A variation of the above assay is to transform or transfect an appropriate host cell with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an active domain, and a portion of α d or Primary hybrid DNA sequences encoding all primary fusions and activation domains of DNA binding domains or transcription factors are expressed in the host cell and subjected to some or all of the potential α d binding proteins and to DNA binding domains or primary fusions. Α in particular in the host cell by expressing in the host cell a library of secondary hybrid DNA sequences encoding the secondary fusion of the activating domain of the transcription factor not included and detecting the production of reporter gene products in the host cell. detecting the binding of the binding protein and the d, α d binding from a particular host cell of By separating the second hybrid DNA sequences encoding a protein it can be used to isolate a polynucleotide encoding a protein that binds to α d.
    [23] In a preferred embodiment using cleavage hybrid analysis, the present invention provides
    [24] (a) a first selectable marker gene encoding a primary selectable marker protein and a repressor gene encoding a suppressor protein, wherein the refresher gene is a host cell in a primary DNA expression construct under the transcriptional control of the promoter Transforming or transfecting,
    [25] (b) a second selectable marker gene encoding a second selectable marker protein and a third selectable marker gene encoding a third selectable marker protein, wherein the third selectable marker gene is under the transcriptional control of the operator The operator transforms or transforms the host cell into a secondary DNA expression construct that is specifically operated by the inhibitory protein such that the interaction of the inhibitory protein with the operator reduces the expression of the tertiary selectable marker protein. Infecting,
    [26] (c) quaternary select the fourth selectable marker gene and the α d fusion protein gene transcription domain of a transcriptional activation protein DNA binding domain or the transcriptional activation protein encoding the α d protein within the framework encoding the marker protein, or Transforming or transfecting a fragment thereof,
    [27] (d) a quaternary selectable marker gene encoding a quaternary selectable marker protein, neither of which is included in the primary fusion protein gene, and in the transcriptional domain and backbone of the DNA binding domain or transcriptional activation protein of said transcriptional activation protein transforming or transfecting a host cell with a quaternary DNA expression construct comprising a secondary fusion protein gene encoding an α d binding protein or binding fragment thereof,
    [28] (e) the α d protein or fragment thereof and the α d binding protein or binding fragment thereof are contiguous with the DNA binding domain and the transactivation domain reconstructs and interacts with the transcription activating protein such that the α d protein or fragment thereof Propagating the host cell under conditions such that expression of the fragment and the α d binding protein or fragment thereof is possible, wherein the transcriptional activating protein acts on the promoter to increase the expression of the inhibitory protein; The inhibitory protein interacts with the operator such that the tertiary selectable marker protein is not transduced;
    [29] (f) detecting the absence of expression of said selectable gene,
    [30] (g) propagating the host cell in the presence of a test inhibitor of binding between the α d protein or fragment thereof and the α d binding protein or fragment thereof,
    [31] (h) the selectable marker in the presence and absence of the test inhibitor so that the transcriptional activation protein is not reconstituted, the expression of the inhibitory protein is not increased, and the operator increases the expression of the selectable marker protein. Comparing the expression of the protein, wherein reduced expression of the selectable marker protein is the ability of the test inhibitor to inhibit binding between the α d protein or fragment thereof and the α d binding protein or binding fragment thereof It provides a method for identifying an inhibitor of binding between the α d protein or fragment thereof and the α d binding protein or binding fragment thereof.
    [32] The present invention relates to a host cell in which one or more of the repressor genes, selectable marker genes, α d fusion protein genes and α d binding protein genes are encoded in a distinct DNA transgenic construct, as well as various genes and regulatory sequences on a single DNA molecule. Host cells to be encoded. In a preferred embodiment, the host cell is transformed or transfected with a DNA encoding a repressor gene, a selectable marker gene, an α d fusion protein gene and an α d fusion binding protein gene, each encoded in a distinct expression construct. do. Despite the number of DNA expression constructs introduced, each transformed or transformed DNA expression construct further comprises a selectable marker gene sequence, wherein the expression indicates that the transfection or transformation has actually occurred. It is used to confirm that. Individually transformed into or transfected DNA transfected expression consisting of a selectable marker encrypted in the gene, by, i.e. tet operator that is the core in the embodiments in which Expression of the selectable marker gene is regulated by the tet operator Preferred selectable Selectable marker genes that regulate the expression of the marker genes are identifiable from selectable markers under transcriptional control of the tet operator, such that the expression of the selectable marker genes will provide a measurable phenotypic change in the host cell used to identify the binding protein inhibitor. Do. Selectable marker genes encoded in individually transformed or transfected DNA expression constructs serve as a measure of successful transfection or transformation of each DNA expression construct. Preferred host cells of the present invention are transgenic, designated YI596 and YI584, deposited with ATCC, 20852 Rockville Bacron Drive 12301, Maryland, USA, on August 13, 1996, and assigned accession numbers ATCC 74384 and ATCC 74385, respectively. S. S. cerevisiae strains.
    [33] Host cells of the present invention can be transformed or transfected with functional promoter and operator sequences that control the expression of heterogeneous proteins as described above and express the necessary α d and α d binding proteins as described above. It includes any cell type that can. In a preferred embodiment, the host cell is of mammalian, insect or yeast origin. Currently, most preferred host cells are yeast cells. Preferred yeast cells of the invention are as described in Table 1 below. It can be selected from a variety of strains, including yeast transformants in cerevisiae. Another example of a yeast sample is S. S. pombe , K. K. lactis , p. Pastoris , S. S. carlsbergensis and seeds. C. albicans . Examples of preferred mammalian host cells of the invention include Chinese hamster ovary (CHO), COS, HeLa, 3T3, CV 1, LTK, 293T3, Ratl, PC12 or any other transfectable cell line of human or rodent origin, and the like. have. Preferred insect cell lines include SF9 cells.
    [34] In a preferred embodiment, the selectable marker gene is controlled by an operator, wherein the expression of the selectable marker protein is required for the propagation of the host cell such that the expression of the selectable marker protein is required for propagation of the host cell on a medium lacking the nutritional requirement. Encode enzymes in the pathway for synthesis. Thus, as in the preferred embodiment where the inhibitory protein interacts with the operator, the transcription of the selectable marker gene is down regulated and the host cell is incapable of proliferating on media lacking nutritional requirements and on media containing nutritional requirements. Is identified by the possibility of proliferation. In the most preferred embodiment, the selectable marker gene encodes the HIS3 protein and the host cell transformed or transfected with the HIS3-encoding DNA expression construct selects subsequent proliferation on the medium in the presence and absence of histidine. However, the present invention includes any of a number of alternative selectable marker genes controlled by an operator. Gene replacements are, for example, encoding URA3, LEU2, LYS2, or any number of any enzymes required for various pathways for the generation of nutritional requirements that may be excluded in definition from growth media. In addition, conventional reporter genes such as chloramphenicol acetyltransferase (CAT), firefly luciferase, β-galactosidase (β-gal), secreted alkaline phosphatase (SEAP), green fluorescent protein (GFP) , Human growth hormone (hGH), β-glucuronidase, neomycin, hygromycin, thymidine kinase (TK) and the like can be used in the present invention.
    [35] In a preferred embodiment, an example of a host cell is an inhibitory protein gene that encodes a tetracycline protein that acts on the tet operator to reduce the expression of a selectable marker gene. However, the present invention also includes tet refreshers and operators, for example, Ecoli trp refreshers and operators, his refreshers and operators, lac operon refreshers and replacements for operators.
    [36] The DNA binding domain and the transactivation domain component of the fusion protein form a functional transcriptional activation protein that increases the expression of the inhibitor protein with high efficiency that the two domains are brought close through the binding between the α d and α d binding proteins. As long as this is possible, it may be derived from the same transcription factor or may be derived from different transcription factors. Highly efficient transcription activating proteins are defined as having both a transactivation domain with high affinity binding to the transcriptional machinery protein required to express the repressor gene mRNA and a DNA binding domain exhibiting high affinity binding to the recognized promoter sequence. do. The DNA binding domain component of the fusion protein of the invention can be derived from any of a variety of different proteins, including, for example, LexA or Gal4. Similarly, the transactivation component of the fusion protein of the invention can be derived from a number of various transcriptional activation proteins, including for example Gal4 or VP16.
    [37] The promoter sequence of the present invention that regulates transcription of the repressor protein may be any sequence capable of inducing transcription in a selected host cell. The promoter may be a DNA sequence specifically recognized by the selected DNA binding domain of the present invention, or any other DNA sequence in which the DNA binding domain of the fusion protein is capable of high affinity interaction. In a preferred embodiment of the invention, the promoter sequence of the invention is an HIS3 or alcohol dehydrogenase (ADH) promoter. In the most preferred embodiment, the ADH promoter is used in the present invention. However, the present invention includes a number of alternative promoters, including those derived from genes encoding HIS3, ADH, URA3, LEU2 and the like.
    [38] The method of the invention includes any and all variations in host cells as described above. In particular, in the present invention, the host cell is a yeast cell, the selectable marker gene encodes HIS3, the transcription of the selectable marker gene is regulated by the tet operator, the repressor protein gene encodes a tetracycline resistant protein, Transcription of cyclin resistant proteins is regulated by the HIS3 promoter, including DNA binding domains derived from LexA and transactivation domains derived from VP16. In another embodiment, the invention provides that the host cell is a yeast cell, the selectable marker gene encodes HIS3, the transcription of the selectable marker gene is regulated by the tet operator, and the repressor protein gene is a tetracycline resistant protein. And transcription of the tetracycline resistant protein is regulated by an alcohol dehydrogenase promoter, DNA binding domain is derived from LexA, and transactivation domain is derived from VP16.
    [39] In another embodiment of the invention wherein the host cell is a mammalian cell, the mutation comprises the use of a mammalian DNA expression construct encoding an α d and α d binding fusion gene, a repressor gene, and a selectable marker gene and an antibiotic or Use of selectable marker genes that encode drug resistance markers (eg, neomycin, hygromycin, thymidine kinase).
    [40] There are three or more different types of libraries used for the identification of small molecule regulatory factors. Examples thereof include (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries of random peptides, oligonucleotides, or organic molecules.
    [41] Chemical libraries consist of compounds identified as "hits" through selection of structural analogues or natural products of known compounds. Natural product libraries are collections of microorganisms, animals, plants or marine organisms, which are mixtures for selection by (1) fermentation and extraction of broth from soil, plant or marine microorganisms or (2) extraction of plant or marine organisms. Used to generate Combinatorial libraries consist of a mixture of multiple peptides, oligonucleotides or organic compounds. They are relatively easy to prepare by conventional automated synthesis, PCR, cloning or proprietary synthesis. Of particular interest are peptide and oligonucleotide combination libraries. Examples of other important libraries include peptides, proteins, peptidomimetic, multiparallel synthetic collections, recombinant and polypeptide libraries.
    [42] Hybridoma cell lines that produce antibodies with specificity for α d are also included in the present invention. Techniques for generating hybridomas that secrete monoclonal antibodies are well known in the art. Hybridoma cell lines can be generated after immunization of the animal with cells that express purified α d , α d , or α d or its regulatory factors, purified on the extracellular membrane surface. Examples of immunogen cell types include cells that express α d in vivo, or transfected eukaryotic or prokaryotic cell lines that typically do not express α d in vivo. Preferred antibodies of the invention are 169A, 169B, 170D, 170F, 170E, 170X, 170H, 188A, 188B, 188C, 188E, 188F, 188G, 1881, 188J, 188K, 188L, 188M, 188N, 188P, 188R, 188T, 195A, 195C, 195D, 195E, 195H, 197A-1,197A-2,197A-3,197A-4,199A, 199H, 199M, 205A, 205C, 205E, 212A, 212D, 217G, 217H, 217I, 217K, 217L, 217M, Hybrid represented as 226A, 226B, 226C, 226D, 226E, 226F, 226G, 226H, 226I, 236A, 236B, 236C, 236F, 236G, 236H, 236I, 236K, 237L, 236M, 240F, 240G, 240H and 236L Secreted by cutting board.
    [43] The value of the information contributed by the disclosure of the DNA and amino acid sequences of α d is evident. In a series of examples, the disclosed α d CDNA sequences allow for the separation of human α d genomic DNA sequences, including transcriptional control factors for genomic sequences. Also included are the identification of α d allele regulatory factors and heterologous species (eg, rat or mouse) DNA. Isolation of human α d genomic DNA and heterologous species DNA can be accomplished by standard DNA / DNA hybridization techniques using all or part of the α d cDNA sequence as a probe to select the appropriate library under appropriate stringent conditions. Alternatively, polymerase chain reaction (PCR) using oligonucleotide primers designed based on known cDNA sequences can be used to amplify and identify genomic α d DNA sequences. Synthetic DNA encoding α d polypeptides, including fragments and other regulatory factors thereof, can be produced by conventional synthetic methods.
    [44] In addition, the DNA sequence information of the present invention is a homologous recombination or “knockout” strategy for generating rodents that failed to express a functional α d polypeptide or to modulate a regulatory α d polypeptide. Eg, Kapecchi, Science 244: 1288-1292 (1989). Such rodents are useful as models for studying the activity of α d and α d regulatory factors in vivo.
    [45] In addition, the DNA and amino acid sequences of the present invention enable analysis of α d epitopes that actively participate in reverse receptor binding, as well as epitopes that can regulate binding rather than actively participate in binding. Identification of epitopes capable of participating in dural signal transduction is also included in the present invention.
    [46] In addition, the DNA of the present invention is useful for the detection of cell types that express α d polypeptides. Standard DNA / RNA hybridization techniques using α d DNA to detect α d RNA are used to measure the levels of constitutive levels of α d transcription in cells, as well as changes in transcription levels in response to internal or external agents. can do. Identification of agents that modify the transcription and / or translation of α d may in turn assess potential therapeutic or prophylactic importance. In addition, the DNA of the present invention enables in situ hybridization of α d DNA to cellular RNA to measure intracellular localization of α d specific messages in complex cell populations and tissues.
    [47] The DNA of the present invention is useful for the identification of non-human polynucleotide sequences that show homology to human α d sequences. Inclusion of non-human α d DNA sequences allows for the development of animal models of human strains (eg, including transgenic models).
    [48] In a further embodiment of the invention, the blade or the polyclonal monoclonal antibody to having specificity to α d it can be used in immunohistochemical analysis to localize the α d to the cell and compartments or individual cells within tissues. This type of immunohistochemical analysis is particularly useful when used in combination with in situ hybridization to localize both the α d mRNA and polypeptide products of the α d gene.
    [49] Identification of cell types that express α d can have important consequences for the development of therapeutic and prophylactic agents. The products of the invention associated with α d can be used for the treatment of diseases wherein macrophages are an essential factor in the course of the disease. Animal models for a number of pathological conditions associated with macrophage activity have been described in the prior art. For example, in mice, macrophage escalation to sites of both chronic and acute infections is described by Jutila, et al., J. Leukocyte Biol. 54: 30-39 (1993). In rats, Adams, et al., Transplantation 53 : 1115-1119 (1992) and Transplantation 56 : 794-799 (1993) describe a model for graft atherosclerosis after heterotrophic abdominal cardiac allograft transplantation. . Rosenfeld, et al., Arteriosclerosis 7 : 9-23 (1987) and Arteriosclerosis 7 : 24-34 (1987) describe induced atherosclerosis in rabbits fed a cholesterol supplemented diet. Hanenberg, et al., Diabetologia 32 : 126-134 (1989) report spontaneous development of insulin-dependent diabetes in BB rats. Yamada et al., Gastroenterology 104 : 759-771 (1993) describe chronic granulomatous colitis, an induced inflammatory bowel disease in rats after injection of the streptomopetic peptidoglycan-polysaccharide polymer. Cromartie, et al., J. Exp. Med. 146 : 1585-1602 (1977) and Schwab, et al., Infection and Immunity 59 : 4436-4442 (1991), injecting streptococcal cell wall proteins into rats to characterize joint destruction following infection of peripheral joints. It has been reported to cause arthritis symptoms. Finally, Huittinga, et al., Eur. J. Immunol 23 : 709-715 (1993) describes experimental allergic encephalomyelitis, a model for multiple sclerosis in Lewis rats. In each model, the α d antibody, other α d binding proteins, or soluble forms of α d are used to attenuate the disease state, possibly through inactivation of macrophage activity.
    [50] Pharmaceutical compositions for the treatment of such disease states and other disease states are provided by the present invention. Pharmaceutical composition α d and the entire α d polypeptide or derivatives which have been designed for the purpose of inhibiting the interaction of its ligand (s), actively participating in a variety of soluble and membrane associated forms (α d binding of α d Intracellular or of α d binding activity, including fragments), soluble and membrane related forms of α d binding proteins (including antibodies, ligands, etc.), residues, translation, post-translational processing and / or regulatory factors of intracellular transport Extracellular regulatory factors and / or regulatory factors for α d and / or α d -ligand polypeptide expression.
    [51] The present invention also encompasses a method for treating a disease state in which alpha d binding or localized accumulation of cells expressing α d is involved, wherein the level of α d binding is expressed in a patient suffering from this disease state. A pharmaceutical composition of the invention is provided in an amount sufficient to modulate or regulate the accumulation of cell types that express α d . The treatment method of the present invention can be applied to, for example, but not limited to, diseases such as type I diabetes, atherosclerosis, multiple sclerosis, asthma, psoriasis, pulmonary infection, acute respiratory distress syndrome and rheumatoid arthritis.
    [52] The present invention also provides a method of inhibiting macrophage infiltration at a site of central nervous system injury, comprising administering to a subject an effective amount of an anti-α d monoclonal antibody. In one embodiment, such methods include the use of anti-α d monoclonal antibodies that block binding between α d and a binding partner. In one embodiment, the binding partner is VCAM-1. In a preferred embodiment, the anti-α d monoclonal antibody is selected from the group consisting of monoclonal antibodies secreted by hybridoma 226H and monoclonal antibodies secreted by hybridoma 236L. In the most preferred embodiment, the method of the present invention relates to central nervous system damage, which is a spinal cord injury.
    [53] The present invention also provides a method for reducing the infection in the central nervous system lesion comprising administering a monoclonal antibody to a subject with an effective amount of monoclonal anti -α d. In one embodiment, this method α d and The use of anti-α d monoclonal antibodies that block binding between binding partners. In one embodiment, the binding partner is VCAM-1. In one embodiment, the anti-α d monoclonal antibody is selected from the group consisting of monoclonal antibodies secreted by hybridoma 226H and monoclonal antibodies secreted by hybridoma 236L. In the most preferred embodiment, the method of the present invention relates to central nervous system injury, which is spinal injury.
    [54] Hybridomas 226H and 236L were deposited on November 11, 1998 by ATCC, Massachus University University Boulevard 10801, Virginia, under the Budapest Treaty, and assigned accession numbers HB12592 and HB-12593, respectively.
    [55] The present invention also provides a method for modulating TNFα release from macrophages or spleen phagocytes comprising contacting said phagocytes with an effective amount of an immunospecific α d monoclonal antibody. In a preferred embodiment, the methods of the present invention comprise antimonoclonal antibodies that inhibit TNFα release. In one embodiment, the methods of the present invention comprise immunospecific anti-α d monoclonal antibodies selected from the group consisting of monoclonal antibodies secreted by hybridoma 205C and monoclonal antibodies secreted by hybridoma 205E. Includes the use of.
    [56] The method of the invention is one in which the useful antibodies include fragments of anti-α d monoclonal antibodies, including, for example, Fab or F (ab ′) 2 fragments. Methods of using modified antibodies are also included in the present invention. Examples of modified antibodies include humanized antibodies, as well as single chain antibodies, chimeric antibodies and CDR-grafted antibodies, including compounds comprising CDR sequences that specifically recognize polypeptides of the invention. Also included are methods involving the use of human antibodies. Techniques for identifying and isolating human antibodies are described below.
    [57] The present invention also provides a method of inhibiting macrophage infiltration at a site of central nervous system injury comprising administering to a subject an effective amount of a small molecule that inhibits α d binding. In particular, the methods of the present invention include central nervous system damage, which is spinal cord injury. Small molecules with specificity for α d binding are identified as discussed above and separated from the library.
    [58] The present invention provides a method for reducing infiltration at a site of central nervous system injury comprising administering to a subject an effective amount of a small molecule that inhibits α d binding. In particular, the methods of the present invention include central nervous system damage, which is a spinal cord injury. As mentioned above, small molecules with specificity for α d binding are identified and separated from the library.
    [59] The invention also includes obtaining a tissue sample from a patient, staining the sample using an anti-α d monoclonal antibody, and comparing the staining pattern on tissue obtained from a known, known donor. Methods for detecting and diagnosing Crohn's disease. If staining differences between two tissue samples can be detected, the patient may be further tested for possible Crohn's disease.
    [60] The invention also relates to the use of α d as a target for the removal of a pathogenic cell population which expresses α d on the cell surface. In one embodiment, the high variability region of the α d monoclonal antibody is cloned and expressed in the environment of human homozygous fixed complement. Cloning the hypervariable region in this manner provides a binding partner for α d , which induces complement binding upon in vivo binding and subsequently leads to cell death. Alternatively, anti-α d monoclonal antibodies are incorporated into cytotoxic compounds and binding of the antibody to α d on pathogenic cell types results in cell death.
    [61] In addition, the present invention provides a method for promoting motor recovery after spinal cord injury, inhibiting motor injury, or limiting motor injury after spinal cord injury by administering an effective amount of anti-α d monoclonal antibody to a spinal cord injury patient. . It also relates to a method for limiting autonomic and sensory dysfunction after spinal cord injury by administering an effective amount of anti-α d monoclonal antibody to a spinal cord injury patient. In one embodiment, the anti-α d monoclonal antibody is a 217L or 226H antibody. In another embodiment, the anti-α d monoclonal antibody competes with 217L or 226H for binding to α d . In further embodiments, the anti-α d monoclonal antibody inhibits α d binding to the α d ligand. Examples of α d ligands are ICAM-R and VCAM-1. Examples of spinal cord injuries treated by this method include compressing the spinal cord.
    [62] Brief description of the drawings
    [63] Many other embodiments and advantages of the invention will be apparent with reference to the following description and drawings.
    [64] 1A-1D include an alignment of human amino acid sequences of CD11b (SEQ ID NO: 3), CD11c (SEQ ID NO: 4) and α d (SEQ ID NO: 2).
    [65] Detailed description of the invention
    [66] The invention is illustrated by the following examples in connection with the isolation of cDNA clones encoding α d from the human spleen cDNA library. In particular, Example 1 illustrates the use of anti-dog α TM1 antibodies intended to detect homologous human proteins. Example 2 describes the N-terminal sequencing of polypeptides for the purification of dog α TM1 and for designing oligonucleotide primers for PCR amplification of the dog α TM1 gene. Example 3 describes mass purification of dog α TM1 for internal sequencing to design additional PCR primers. Example 4 illustrates the use of PCR and internal sequence primers to amplify fragments of the dog α TM1 gene. Example 5 describes the cloning of human α d -encoding cDNA sequences. Example 6 describes a Northern blot hybridization assay of human tissues and cells for the expression of α d mRNA. Example 7 describes the structure of human α d expression plasmids and transfection of COS cells using the resulting plasmids. Example 8 describes an ELISA assay of α d expression in transfected COS cells. Example 9 describes a FACS assay transfected with COS cells with a human α d expression plasmid. Example 10 describes immunoprecipitation of CD18 associated with α d in co-infected COS cells. Example 11 relates to stable transfection of α d expression constructs in Chinese hamster ovary cells. Example 12 describes CD18-dependent binding of α d to the ICAM-R variant protein, an intercellular adhesion molecule ICAM-R, and complement fact iC3b. Example 13 describes a flash proximity screening assay to identify inhibitors or enhancers (ie, regulatory factors) of α d ligand / anti-ligand binding interactions. Example 14 describes the construction of the expression plasmid encoding the soluble form of α d and binding analysis of the expression product. Example 15 relates to the production of α d -specific polyclonal serum and monoclonal antibodies. Example 16 describes a flow cytometry assay using a d monoclonal antibody. Example 17 describes the expression of α d on human monocytes. Example 18 provides a distribution of α d tissue, expression of α d on peripheral blood leukocytes, expression in inflammatory and non-inflammatory lubricants with anti-α d polyclonal serum, traits in lung and liver, human bone marrow disease. Expression and analysis of PBMCs from breast cancer patients are described. Example 19 describes in vitro and in vivo upregulation of α d expression. Example 20 describes the isolation of rat cDNA sequences showing homology to human α d gene sequences. Example 21 describes tissue specific expression of rat α d mRNA. Example 22 shows the construction of α d I domain expression plasmids including I domain / IgG fusion proteins, the construction of full length rat α d expression plasmids, generation of monoclonal antibodies against full length and I domain fusion proteins, fused to human IgG4. The production of polyclonal antiserum against rat α d I domain sequences is described. Example 23 describes the specificity of monoclonal antibody 199M. Example 24 shows the results of a T cell proliferation assay using rat α d which expresses macrophages. Example 25 describes immunoprecipitation of rat α d from bone marrow. Example 26 describes rat α d expression in various animal models. Example 27 relates to an assay for the inhibition of NK-tumor cell induced target cell lysis using α d monoclonal antibodies. Example 28 shows the isolation of mouse cDNA sequences showing homology to human α d gene sequences. Example 29 describes the isolation of additional mouse α d cDNA clones used to confirm sequence analysis. Example 30 describes in situ hybridization assays of various mouse tissues to determine tissue and cell specific expression of potential mouse homologues for human α d . Example 31 describes the generation of transgenic constructs encoding the potential mouse homologues of human α d . Example 32 describes the design of a “knockout” mouse, wherein the gene encoding the potential mouse homologue of human α d is disrupted. Example 33 shows the isolation of rabbit cDNA clones showing homology to human α d coding sequence. Example 34 shows the isolation of monkey α d . Example 35 relates to the properties of antigens recognized by monoclonal antibody 217L. Example 36 describes an animal model of a human disease state in which modulation of α d is analyzed for therapeutic properties. Example 37 describes the expression of α d in animal model disease states. Example 38 describes the role of α d in spinal cord injury. Example 39 describes α d expression in Crohn's disease. Example 40 relates to TNFα release from rat spleen cells that express α d . Example 41 describes a method of modulating TNFα release from spleen cells using α d monoclonal antibodies. Example 42 characterizes α d expression on eosinophils. Example 43 relates to further characterizing the properties of α d binding to VCAM-1. Example 44 illustrates the use of α d as a target for the removal of a pathogenic cell population.
    [67] Example 1
    [68] Dog α TM1Attempt to detect human homologues
    [69] A monoclonal antibody Ca11.8H2 having specificity for dog α TM1 [Moore, et al., Hom .] Was tested for cross reactivity to human peripheral blood leukocytes in an attempt to identify human homologues of dog α TM11 . It was. Cell preparation (typically 1 × 10 6 cells) was incubated with undiluted hybridoma supernatant or purified mouse IgG-negative control antibody (10 μg / ml) on ice in the presence of 0.1% sodium azide. Subsequent incubation with FITC-conjugated horse anti-mouse IgG (Vectorler Laboratories, Burlingame, CA) at 6 μg / ml detected monoclonal antibody binding. Stained cells were fixed with 2% w / v paraformaldehyde in phosphate buffered saline (PBS) and analyzed using a Facstar Plus fluorescence-activated cell sorter (Becton Dickinson, Mountain View, CA). Typically 10,000 cells were analyzed using log amplification for fluorescence intensity.
    [70] These results indicated that Ca11.8H2 did not cross-react with the surface protein expressed in human peripheral blood leukocytes, but tumor dog peripheral blood lymphocytes as control cells were substantially positive for α TM1 .
    [71] Since the monoclonal antibody Ca11.8H2 having specificity for the dog subunit does not cross-react with human homologues, separation of dog α TM1 DNA appears to be an essential condition for the separation of the corresponding human gene if present.
    [72] Example 2
    [73] Α for N-terminal sequencing TM1Affinity Tablets
    [74] Dog α TM1 was affinity purified to determine the N-terminal amino acid sequence for oligonucleotide probe / primer design. Briefly, anti-α TM1 monoclonal antibody Ca11.8H2 is coupled to Apigel® chromatography resin (Biorad, Hercules, Calif.), And proteins are isolated by specific antibody-protein interactions. It was. Antibodies were conjugated to the resin at a concentration of about 5 mg antibody per ml of resin by the protocol proposed by Biored. After the conjugation reaction, excess antibody was removed and the resin was blocked with 3 volumes of 0.1 M ethanolamine. The resin was then washed with 30 column volumes of phosphate buffered saline (PBS).
    [75] 25 g of single dog spleens were homogenized using a protease inhibitor in 250 ml buffer containing 0.32 M sucrose in 25 mM Tris-HCl, pH 8.0. Nuclei and cell debris were pelleted by centrifugation at 1,000 g for 15 minutes. The membrane was pelleted from the supernatant at 100,000 g for 30 minutes. The membrane pellet was resuspended in 200 ml of lysis buffer (50 mM NaCl, 50 mM borate, pH 8.0, 2% NP-40) and incubated for 1 hour on ice. Insoluble material was pelleted by centrifugation at 100,000 g for 60 minutes. 10 ml of clear lysate was transferred to a 15 ml polypropylene tube containing 0.5 ml of Ca11.8H2-conjugated Apigel 10 resin as described above. The tube was incubated overnight at 4 ° C. under rotation, after which the resin was washed with 50 column volumes of D-PBS. Transfer the resin to a microfuge tube, which is 1 ml Laemmli (non-reducing) sample containing 0.1 M Tris-HCl, pH 6.8, 2% SDS, 20% glycerol and 0.002% bromophenol blue for 10 minutes. Boil in buffer. The resin was pelleted by centrifugation, decanted, and the supernatant was treated with 1/15 volume of β-mercaptoethanol (Sigma, St. Louis, MO) and processed on a 7% polyacrylamide gel. The isolated protein was transferred to an Immobilon PVDF membrane (Millipore, Bedford, Mass.) As follows.
    [76] The gel was washed once in deionized Millipore® filtered water and washed with 10% methanol in 10 mM 3- [cyclohexylamino] -1-propanesulfonic acid (CAPS) transition buffer, pH 10.5, 15 Equilibration was performed for ˜ 45 minutes. The Immobilon membrane was wetted with methanol, washed with filtrate and equilibrated in CAPS transition buffer for 15-30 minutes. Initial transfer was performed for 3 hours at 70 V using a Biorad transition device. After the transfer, the Immobilon membrane was removed and stained for 10 minutes in filtered 0.1% R250 Coomassie staining. The membrane was decolorized three times in 50% methanol / 10% acetic acid for 10 minutes each time. After bleaching, the membrane was washed with filtered water and air dried.
    [77] Protein bands of about 150 kD, 95 kD, 50 kD and 30 kD were detected. Perhaps the 50 kD and 30 kD bands are due to antibody contamination. N-terminal sequencing was then attempted for both 150 kD and 95 kD bands, but blocking 95 kD protein prevented sequencing. A 150 kD protein band was excised from the membrane and directly sequenced using Appleride Biosystems (Foster City, Calif.) Model 473A Protein Sequence Analyzer according to the manufacturer's instructions. The resulting amino acid sequence is shown in SEQ ID NO: 5 using single letter amino acid notation.
    [78] FNLDVEEPMVFQ (SEQ ID NO: 5)
    [79] The identified sequences include the FNLD sequence properties of the α subunit with integrins. Tamura, et al., J. Cell. Biol . 111: 1593-1604 (1990).
    [80] Primer design and α TM1Attempt to Amplify Sequence
    [81] Three oligonucleotide probes were designed for hybridization from N-terminal sequence information. a) "Tommer" means a fully degenerate oligonucleotide; b) "Patmer" refers to a partially degenerate oligonucleotide; c) "Guessmer" is a non-degenerate oligonucleotide based on mammalian codon usage. These probes are shown below as SEQ ID NOS: 6,7 and 8, respectively. Nucleic acid symbols refer to 37 C.F.R. for these and all other nucleotide sequences. Under §1.882.
    [82] 5'-TTYAAYYTGGAYGTNGARGARCCNATGGTNTTYCA-3 '(SEQ ID NO: 6)
    [83] 5'-TTCAACCTGGACGTGGAGGAGCCCATGGTGTTCCAA-3 '(SEQ ID NO: 7)
    [84] 5'-TTCAACCTGGACGTNGAASANCCCATGGTCTTCCAA-3 '(SEQ ID NO: 8)
    [85] Based on sequencing data, these oligonucleotides in several low stringency hybridizations to spleen / peripheral blood macrophage cDNA libraries in dogs cloned into λZAP® (stratazine, Lazola, Calif.) No relevant clones were detected using.
    [86] 5'Deg, 5'Spec, 3'Deg and 3'Spec (as shown in SEQ ID NOS: 9, 10, 11 and 12, respectively, where Deg represents degenerate and Spec represents non-degenerate) Four other oligonucleotide primers, designated as, were subsequently designed based on the N-terminal sequence inferred to amplify the dog α TM1 sequence by PCR from phage library DNA purified from the plate lysates of the stratazine library described above.
    [87] 5'-TTYAAYYTNGAYGTNGARGARCC-3 '(SEQ ID NO: 9)
    [88] 5'-TTYAAYYTGGACGTNGAAGA-3 '(SEQ ID NO: 10)
    [89] 5'-TGRAANACCATNGGYTC-3 '(SEQ ID NO: 11)
    [90] 5'-TTGGAAGACCATNGGYTC-3 '(SEQ ID NO: 12)
    [91] α TM1 oligonucleotide primers are paired with T3 or T7 vector primers as shown in SEQ ID NOS: 13 and 14, respectively, and flanked by the polylinker site in Bluescript phagemid found in λZAP® Hybridize to the sequence.
    [92] 5'-ATTAACCCTCACTAAAG-3 '(SEQ ID NO: 13)
    [93] 5'-AATACGACTCACTATAG-3 '(SEQ ID NO: 14)
    [94] PCR amplification was performed on Taq buffer containing 150 ng of library DNA, 1 μg of each primer, 200 μM dNTP and 2.5 units of Taq polymerase (Boehringer Mannheim) and magnesium (Boehringer Mannheim, Indianapolis, IN). The product was separated by electrophoresis on 1% agarose gel in Tris-acetate EDTA (TAE) buffer containing 0.25 μg / ml ethidium bromide. The DNA was transferred to a Highbond® (Amersham, Arlington Heights, Ill.) Membrane by wicking overnight in 10 × SSPE. After transfer, the immobilized DNA was denatured with 0.5 M NaOH with 0.6 M NaCl, neutralized with 1.0 M Tris-HCl, pH 8.0d in 1.5 M NaCl, washed with 2X SSPE, and then stratalinker (stratazine) UV crosslinking was done using a crosslinking device. Membranes were incubated for 2 hours at 50 ° C. in prehybridization buffer (5X SSPE, 4X Denhardts, 0.8% SDS, 30% formamide).
    [95] Oligonucleotide probes 5'Deg, 5'Spec, 3'Deg and 3'Spec (SEQ ID NOS: 9,10,11 and 12 respectively) were subjected to 100-300 μCi γP 32 -dATP and 1-3 units of polynucleotide kinase Beringer Mannheim kinase buffer containing was labeled for 1 to 3 hours at 37 ℃. Labels unincorporated using Sephadex® G-25 fine powder (Pharmacia, Piscataway, NJ) using 10 mM Tris-HCl, pH 8.0, 1 mM EDTA (TE) buffer Was removed and the flow rate was added directly to the prehybridization solution. The membrane was probed under stirring at 42 ° C. for 16 hours, which was repeatedly washed at 50 ° C. for 15 minutes with a final stringent wash of 1 × SSPE / 0.1% SDS. The blot was then exposed to Kodak X-Omat AR film at -80 ° C for 1-4 hours.
    [96] Only the oligonucleotides 5'Deg, 5'Spec, 3'Deg and 3'Spec were hybridized to the PCR product from the reaction used as the primer, and as expected on the PCR product from the reaction not used as the primer. I could not let you. Thus, it was drawn to the conclusion that none of the PCR products were specific for α TM1 because the products were not hybridized using all of the appropriate probes.
    [97] Example 3
    [98] Dog α for internal sequencing TM1Bulk affinity tablets
    [99] To provide additional amino acid sequences for the primer design, dog α TM1 was purified for internal sequencing. Three sections of frozen spleen (about 50 g each) and frozen cells from two partial spleens from adult dogs were used to generate proteins for internal sequencing. 50 g of the spleen was homogenized using Waring blender in 200-300 mL borate buffer. The homogenized material was diluted with 1 volume buffer containing 4% NP-40 and then the mixture was stirred gently for at least 1 hour. Large debris was removed from the resulting lysate by centrifugation at 2000 g for 20 minutes and then filtered through a Corning (Corning, NY) prefilter or Corning 0.8 micron filter. The lysate was further purified by filtration through a Corning 0.4 micron filter system.
    [100] The spleen lysates and antibody-conjugated Apigel® 10 resins described in Example 2 were combined in 100 ml fractions in a 150: 1 volume ratio and incubated overnight at 4 ° C. under shaking. Lysates were removed after centrifugation at 1000 g for 5 minutes and combined with more antibody-conjugated Apigel® 10 resin and incubated overnight as described above. After the absorbed resin fractions were combined, it was washed with 50 volume D-PBS / 0.1% Tween 20 and the resin was transferred to a 50 ml Biorad column. The adsorbed protein was eluted from the resin with 3-5 volumes of 0.1 M glycine (pH 2.5) and approximately 900 μl of fractions were collected and neutralized with 100 μl of 1 M Tris buffer, pH 8.0. 15 μl of fractions were removed from each fraction and it was boiled in 2 × Laemmli sample eastern skin containing 1/15 volume of 1 M dithiothreitol (DTT). The samples were electrophoresed on 8% Novex (San Diego, CA) polyacrylamide gels, and Kumaji stained using Daiichi kit (Enprotech, Natick, MA) according to the manufacturer's protocol. Visualized by silver staining. Fractions containing the maximum amount of protein were combined and concentrated in vacuo. The balance was diluted 50% with reducing Laemmli sample buffer, which was performed on a 1.5 mm 7% polyacrylamide gel in Tris-glycine / SDS buffer. The protein was transferred from the gel to the Immobilon membrane by the procedure described in Example 2 using a Hoefer transfer device.
    [101] Protein bands corresponding to α TM1 in dogs were excised from 10 PVDF membranes to produce approximately 47 μg total protein. The band was decolorized for 5 minutes in 4 ml of 50% methanol, which was air dried and cut into 1 × 2 mm pieces. Pieces of the membrane were immersed in 2 ml of 95% acetone at 4 ° C for 30 minutes with occasional shaking and then air dried.
    [102] Prior to proteolytic cleavage of the membrane bound protein, 3 mg of cyanogen bromide (CNBr) (Pierce, Rockford, Ill.) Was dissolved in 1.25 mL of 70% formic acid. This solution was added to a tube containing PVDF membrane pieces and the tube was incubated for 24 hours at room temperature in the dark. The supernatant (S1) was transferred to another tube and the membrane pieces were washed with 0.25 ml of 70% formic acid. This supernatant (S2) was removed and added to the previous supernatant (S1). 2 ml of Milli Q water was added to the combined supernatants (S1 and S2) and the solution was lyophilized. The PVDF membrane pieces were dried under nitrogen and extracted again with 1.25 ml of 60% acetonitrile, 0.1% tetrafluoroacetic acid (TFA) at 42 ° C. for 17 hours. This supernatant (S3) was removed and the membrane pieces were again extracted with 1.0 ml 80% acetonitrile containing 0.08% TFA at 42 ° C. for 1 hour. This supernatant (S4) was combined with the previous supernatants (S1, S2 and S3) and dried in vacuo.
    [103] The dried CNBr fragment was dissolved in 63 μl of 8 M urea, 0.4 M NH 4 HC0 3 . The fragments were reduced in 5 μl 45 mM dithiothreitol (DTT) and then incubated at 50 ° C. for 15 minutes. The solution was then cooled to room temperature and 5 μl of 100 mM iodoacetamide (Sigma, St. Louis, MO) was added to alkylate the fragments. After incubation for 15 minutes at room temperature, the samples were diluted to 187 μl Milli Q water to a final urea concentration of 2.0 M. Trypsin (Wattington, NJ) was added with an enzyme: protein in a 1:25 (w: w) ratio and the protein was digested at 37 ° C. for 24 hours. Digestion was terminated by the addition of 30 μl of TFA.
    [104] The protein fragments were then purified using a Waters 625 LC system (2.1 × 250 mm, 5 micron Vydac C-18 column (Bydaq, Hesperia, CA) equilibrated in 0.05% TFA and HPLC water (buffer A). High performance liquid chromatography on Millipore, Milford, Mass., USA. Peptides were eluted with increasing concentrations of 80% acetonitrile in 0.04% TFA (buffer B) in a gradient of 38-75% Buffer B and 75-98% Buffer B for 65-95 minutes for 95-105 minutes. Peptides were fractionated at a flow rate of 0.2 ml / min and detected at 210 nm.
    [105] After fractionation, amino acid sequences of peptides by automated Edman digestion performed on an Applied Biosystems Model 437A Protein Sequence Analyzer using the manufacturer's standard cycle and Model 610A data analysis software program, version 1.2.1, performed on Applied Biosystems Was analyzed. All sequencing agents are supplied by Applied Biosystems. Seven amino acid sequences of the eight internal fragments are described below, where "X" indicates that the identity of the amino acids is not clear.
    [106] VFQEXGAGFGQ (SEQ ID NO: 15)
    [107] LYDXVAATGLXQPI (SEQ ID NO: 16)
    [108] PLEYXDVIPQAE (SEQ ID NO: 17)
    [109] FQEGFSXVLX (SEQ ID NO: 18)
    [110] TSPTFLXMSQENVD (SEQ ID NO: 19)
    [111] LVVGAPLEVVAVXQTGR (SEQ ID NO: 20)
    [112] LDXKPXDTA (SEQ ID NO: 21)
    [113] Primer design
    [114] One internal amino acid sequence obtained (as shown in SEQ ID NO: 22) was used to design a fully degenerate oligonucleotide primer designated p4 (R) as shown in SEQ ID NO: 23.
    [115] FGEQFSE (SEQ ID NO: 22)
    [116] 5'-RAANCCYTCYTGRAAACTYTC-3 '(SEQ ID NO: 23)
    [117] Example 4
    [118] Α TM1PCR Cloning of Fragments
    [119] The 5 'portion of the dog α TM1 gene was amplified from double stranded spleen cDNA by PCR.
    [120] Generation of Double-Strand Dog Spleen cDNA
    [121] One gram of frozen material from the spleen of young dogs is ground in liquid nitrogen on dry ice, and it is crushed in 20 ml of RNA-Stat 60 buffer (Tel-Test Bee, Inc., Friendswood, TX). Homogenized. 4 ml of chloroform were added and the solution was extracted by centrifugation at 12,000 g for 15 minutes. RNA was precipitated from an aqueous layer containing 10 ml of ethanol. Poly A + RNA was selected on Dynal Oligo dT Dynabiz® (Dynal, Oslo, Norway). Five fractions of 100 μg total RNA were combined and diluted with the same amount of 2 × binding buffer (20 mM Tris-HCl, pH 7.5, 1.0 M LiCl, 1 mM EDTA, 0.1% SDS). RNA was then incubated with Oligo dT Dynabeads (1.0 mL or 5 mg of beads for all samples) for 5 minutes. The beads were washed with a buffer containing 10 mM Tris-HCl, pH 7.5, 0.15 M LiCl, 1 mM EDTA and 0.1% SDS by the manufacturer's protocol, followed by 2 mM EDTA, pH 7.5 Poly A + mRNA was eluted. Double stranded cDNA was generated using the poly A + mRNA eluted by the manufacturer's protocol and the Boehringer Mannheim cDNA synthesis kit.
    [122] Partial dog α TM1Isolation of cDNA
    [123] Oligonucleotide primer 5 ′ in a standard PCR reaction using 1.5 units of Taq polymerase (Boehringer Mannheim), 200 μM dNTP, 500 ng of each primer and 150 ng double stranded cDNA in Taq buffer with magnesium (Boehringer Mannheim) Deg (SEQ ID NO: 9) and p4 (R) (SEQ ID NO: 23) were used. The resulting product (1 μl initial reaction) was subjected to the second round of PCR using the same primers to increase the yield of the product. The band was eluted and precipitated from a 1% agarose gel on Schleicher & Schuell (Kinney, NH) paper at 65 ° C. in a buffer containing 10 mM Tris-HCl, pH 8, 1 mM EDTA, 1.5 M NaCl. after that, the manufacturer uses the TA cloning kit (Invitrogen) by a proposed protocol was ligated into pCR tm II vector (Invitrogen of San Diego, Calif). Ligation mixtures were transformed by electroporation to XL-1 blue bacteria (Stratagene). One clone 2.7 was determined to contain a sequence corresponding to α TM1 peptide sequence not used in the design of the primers.
    [124] Asymmetric PCR reactions with fluorescently labeled dNTPs are described in McCabe, "Production of Single Stranded DNA by Asymmetric PCR," in PCR Protocols: A Guide to Methods and Applications , Innis, et al. (eds.) pp. Sequencing was performed with an Applied Biosystems 373A DNA Sequence Analyzer (Foster City, Calif.) Using the Dye-deoxy Terminator Cycle Sequence Kit (ABI) incorporated by 76-83 Academic Press: New York (1990). The sample was held at 96 ° C. for 4 minutes and treated with 25 cycles of step sequences for 15 seconds at 96 ° C., 1 second at 50 ° C., and 4 minutes at 60 ° C. Sequence data was automatically downloaded to a sample file from a computer containing a chromatogram and a text file. The sequence of full insertion of clone 2.7 is shown in SEQ ID NO: 24.
    [125] Attempts to separate full-length α TM1 cDNAs from stratazine libraries (described in Example 2) have not been successful. About 1 × 10 6 phage plaques were selected by hybridization using clone 2.7 as a probe under low stringency conditions using 30% formamide, but no positive clones were produced. Derived from degenerate primer or clone 2.7 based on amino acid sequence from other peptide fragments paired with degenerate oligonucleotides based on the conserved α subunit amino acid motif GFFKR [Thamura, et al., Homology] Attempts to amplify downstream relevant sequences from those shown in clone 2.7 using specific specific oligonucleotides have not been successful.
    [126] Example 5
    [127] Canine Animals α TM1Cloning of the Estimated Human Homolog of
    [128] To isolate human sequence homologs to canine α TM1 , about 1 kb of canine α TM1 fragment obtained from clone 2.7 was used as a probe. This probe was generated by PCR using NT2 (SEQ ID NO: 25) and p4 (R) (SEQ ID NO: 23) as primers under the conditions described in Example 2.
    [129] 5'-GTNTTYCARGARGAYGG-3 '(SEQ ID NO: 25)
    [130] This PCR product was purified using the Quiagen (Chatsword, GA) quick spin kit and protocol proposed by the manufacturer. Purified DNA (200 ng) was labeled with 200 μCi α 32 PdCTP using Boehringer Mannheim's random prime labeling kit and protocol suggested by the manufacturer. Unincorporated isotopes were removed by Sephadex® G25 (fine) gravity chromatography. The probe was denatured with 0.2 N NaOH and neutralized with 0.4 M Tris-HCl (pH 8.0) before use.
    [131] Colony lifts on high-bond® filters (Amersham) of the human spleen cDNA library were prepared in pCDNA / Amp (Invitrogen, San Diego, Calif.). This filter was initially denatured and neutralized as described in Example 2 and then incubated with gentle shaking at 50 ° C. for 2 hours with 30% formamide in a prehybridization solution (8 mL / filter). As mentioned above, the probe was added to this solution and incubated with the filter at 42 ° C. for 14 hours. The filter was washed twice with 2 × SSC / 0.1% SDS at 37 ° C. and twice with 2 × SSC / 0.1% SDS at 50 ° C. The final stringency wash was performed twice at 65 ° C., 1 × SSC / 0.1% SDS (1 × SSC for 150 mM NaCl, 15 mM sodium citrate, pH7.0). The filter was exposed to Kodak X-Omat AR film for 6 hours using a reinforcement screen. Colonies displaying signals on the copy lift were streaked on LB medium plates containing magnesium (LBM) / carbenicillin and incubated overnight at 37 ° C. The formed streaked colonies were transferred to a high bond® filter and then the filters were treated as described above. Under more stringent conditions, these filters were hybridized in 50% formamide hybridization solution at 50 ° C. for 3 hours using a 1 kb probe obtained from labeled clone 2.7 as described above. The probed filter was subjected to a final stringency (0.1 × SSC / 0.1% SDS, 65 ° C.) wash and then exposed to Kodak X-Omat AR film at −80 ° C. for 2.5 hours using a reinforced screen. Positive colonies were identified and incubated overnight in LBM / carbenicillin medium. DNA was prepared from the medium using the Promega® Miniprep Kit according to the manufacturer's recommended protocol and the resulting DNA was sequenced.
    [132] Initial screening confirmed 18 positive colonies, but only one positive colony (named 19A2) was identified in the second screening under more stringent hybridization conditions. The DNA and inferred amino acid sequences of human α d clone 19A2 are shown in SEQ ID NOs: 1 and 2, respectively.
    [133] Human α dProperties of cDNA and Predictive Polypeptides
    [134] Clone 19A2 contains the entire coding region for mature protein and 48 bases (16 amino acid residues) of the 5 'upstream signal sequence and 241 bases in the 3' untranslated sequence that do not terminate in the polyadenylation sequence. The central molecular weight of the mature protein is expected to be approximately 125 kD. The extracellular domain is expected to comprise amino acid residues approximately 17-1108 in SEQ ID NO: 2. This extracellular region is contiguous with about 20 amino acid regions (residues 1109-1128 of SEQ ID NO: 2) homologous to the human CD11c transmembrane region. The cytoplasmic domain contains about 30 amino acids (residues 1129 to 1161 of SEQ ID NO: 2). The protein is also present in the I (insertion) domains (Larson and Springer, homologous), α E [Shaw et al., J. Biol. Chem. 269: 6016-6025 (1994)], which are commonly present in CD11a, CD11b and CD11c. It is homologous and includes a region (approximately residues 150-352) which is about 202 amino acids present in VLA-1 and VLA-2 [Tamura et al., Homologous]. The I domain present in other integrins appears to be involved in ICAM binding [Landis et al., J. Cell. Biol. 120: 1519-1527 (1993); Diamond et al., J. Cell. Biol. 120: 1031-1043 (1993)], suggesting that a d may bind to an ICAM crowd member of a surface molecule. The region has not been demonstrated to be present in any other integrin subunit.
    [135] The inferred amino acid sequence of α d shows about 36% identity with CD11a, about 60% with CD11b and about 66% with CD11c. The arrangement of amino acid sequences for CD11b (SEQ ID NO: 3), CD11c (SEQ ID NO: 4) and α d (SEQ ID NO: 2) is shown in FIG.
    [136] The cytoplasmic domains of the α subunits of β 2 integrins are usually distinct from each other in the same species, but each α subunit exhibits high homology at the species boundary. Consistent with these observations, the cytoplasmic region of α d is distinctly different from CD11a, CD11b and CD11c except for the membrane adjacent to the GFFKR amino acid sequence that appears to be conserved across all α integrins [Rojiani et al., Biochemistry 30: 9859- 9866 (1991). Since the cytoplasmic terminal regions of integrins are involved in "inside out" signaling and affinity regulation [Landis et al., Homologous], α d is distinct from those interacting with CD11a, CD11b and CD11c, It interacts with cytosolic molecules and consequently participates in signaling pathways that are distinct from the pathways involved by other β 2 integrins.
    [137] the extracellular domain of α d comprises a conserved DGSGS amino acid sequence adjacent to the first domain; For CD11b, the DGSGS sequence is a metal binding region required for ligand interaction (Michishita et al., Cell 72: 857-867 (1993)). Three additional putative cation binding sites of CD11b and CD11c are conserved in the α d sequence (SEQ ID NO: 1) of amino acids 465-474, 518-527 and 592-600 of clone 19A2. The α d Ⅰ domains CD11a, CD11b, and the relatively low sequence homology wherein α d is β 2 integrins interact with other known in the area and 36%, 62% and 57% identical, this zone of CD11c To interact with a set of extracellular proteins that are distinct from proteins. Alternatively, the affinity of α d for known β 2 integrin ligands such as ICAM-1, ICAM-2, and / or ICAM-R may be distinguished from those demonstrated for other β 2 integrin / ICAM interactions [implemented]. See example 12].
    [138] Additional Human α for Sequence Verification dIsolation of cDNA Clone
    [139] To identify DNA sequences encoding human α d , additional human cDNA was isolated from the human spleen oligo dt-primed cDNA library (Invitrogen) in pcDNA / Amp (described in Example 5) by hybridization. CDNAs greater than or equal to 3 kb in length were selected by size by agarose gel electrophoresis. Hybridization probes were derived from the 5 'region of α d as described below. Hybridization conditions were followed for isolation of initial human α d clones except that after hybridization the filter was washed twice in 2 × SSC / 0.1% SDS at room temperature and once in 2 × SSC / 0.1% SDS at 42 ° C. Same as described for. The filter was exposed to Kodak X-Omat AR film overnight.
    [140] The 5 'α d hybridization probe was generated by PCR from a 19A2 clone using CD11c 5' For (SEQ ID NO: 94) and CD11c5 'Rev (SEQ ID NO: 95) primers under the following conditions. The sample is left at 94 ° C. for 4 minutes and 15 seconds at the next temperature step, i. E. 94 ° C .; Ii) 30 seconds at 5 ° C; And iii) steps of 1 minute at 72 ° C. were carried out for 30 cycles in a Perkin-Elmer 9600 thermocycler.
    [141] CD11c 5 'For: (5') CTGGTCTGGAGGTGCCTTCCTG (3 ') (SEQ ID NO: 94)
    [142] CD11c 5 'Rev: (5') CCTGAGCAGGAGCACCTGGCC (3 ') (SEQ ID NO: 95)
    [143] Amplification products were purified using the Biorad (Hercules, Prep-A-Gene kit) according to the protocol suggested by the manufacturer. The resulting 5 ′ α d probe was about 720 bases in length, corresponding to the region of nucleotides 1121 to nucleotide 1839 of SEQ ID NO: 1. Purified DNA (about 50 ng) was labeled with 32 P-dCTP using a Boehringer Mannheim (Indianapolis, IN) random prime labeling kit. Unincorporated isotopes were removed using Centricept® spin columns (Princeton Separations, Adelpia, NJ) according to the protocol proposed by the manufacturer. Labeled probes were added to the filters in a prehybridization solution containing 45% formamide and incubated overnight at 50 ° C. After incubation, the filter was washed as described above.
    [144] Thirteen colonies signaled at the copy lift. Positive colonies were picked from the original plate and diluted in LBM and carbenicillin (100 μg / ml), which were plated on a highbond® filter (Amersham) at various dilution rates. After the copy filters were hybridized to the same solution used for the first hybridization, the filters were rinsed in final stringency at 2 × SSC / 0.1% SDS at 42 ° C. and exposed to the film.
    [145] Of the 13 positive colonies initially identified, 10 were identified on the secondary screen. Of these 10 colonies, two (A7.Q and A8.Q) were sequenced and sequences encoding human α d were determined. Clone A7.Q was found to be approximately 2.5 kb in length, including the 5 'leader of the 5' untranslated sequence, some of the coding regions and an additional 60 bases. The incomplete coding region was identified as derived from the abnormally spliced intron region corresponding to nucleotide 2152 of SEQ ID NO: 1. Clone A8.Q was found to be about 4 kb in length, span the entire α d coding region and comprise an intron sequence corresponding to 305 bases of SEQ ID NO: 1. In contrast to the initially isolated α d clone (SEQ ID NO: 1), one difference was observed in that both A7.Q and A8.Q clones had three base CAG codon insertions present at base 1495. . The sequences for clones A7.Q and A8.Q, respectively, set forth in SEQ ID NOs: 96 and 97, and the complex human sequences derived from clones A7.Q and A8.Q, and their corresponding putative amino acid sequences, are shown in SEQ ID NOs: 98 and 99, respectively. Is presented in
    [146] Example 6
    [147] Human α in tissue dNorthern analysis of expression
    [148] In order to determine the relative levels and tissue specificity of α d expression, using a fragment obtained from clone 19A2 as probes, Northern analysis was performed. About 10 μg of total RNA, each derived from several human tissues or cultured cell lines, was loaded onto a formaldehyde agarose gel in the presence of 1 μg of ethidium bromide. After electrophoresis at 100 V for 4 hours, RNA was wicked in 10 × SSC and transferred to nitrocellulose membrane (Schleider & Schuell). The film was baked under vacuum at 80 ° C. for 1.5 hours. The membrane was blocked for 3 hours at 42 ° C. using a prehybridization solution containing 50% formaldehyde in 3- (N-morpholino) propane sulfonic acid (MOPS) buffer. Fragments of clone 19A2 were labeled using Boehringer Mannheim's random prime kit containing α 32 PdCTP and α 32 PdTTP according to the manufacturer's instructions. Unincorporated labels were removed on a Sephadex® G25 column in TE buffer. This membrane was probed at 1.5 × 10 6 counts per 1 ml prehybridization buffer. The blot was then subjected to 2 X SSC / 0.1% SDS at room temperature, 2 X SSC / 0.1% SDS at 42 ° C, 2 X SSC / 0.1% SDS at 50 ° C, 1 X SSC / 0.1% SDS at 50 ° C, 0.5 at 50 ° C. Washing was successively using X SSC / 0.1% SDS and 0.1 X SSC / 0.1% SDS at 50 ° C. The blot was then exposed to the film for 19 hours.
    [149] Hybridization using BstXI fragments (corresponding to nucleotides 2011-3388 of SEQ ID NO: 1) derived from clone 19A2 showed a weak signal in the range of approximately 5 kb of total RNA of the liver, placenta, thymus and tonsils. No signal was seen in the kidney, brain or heart sample. Ethidium bromide staining showed that the amount of RNA present in the kidney lane was minimal.
    [150] When using a second fragment of clone 19A2 (including the 500-2100 base region of SEQ ID NO: 1), two RNA transcripts of different sizes were found in human multiple tissue Northern (MTN) blot using polyA + RNA (Clontech). Detected. A band of about 6.5 kb was observed in the spleen and skeletal muscle, while a band of 4.5 kb was observed in the lung and peripheral blood leukocytes. The observed size differences could be due to tissue specific polyadenylation, cross reactivity of the probe with other integrin group members, or alternatively hybridization with spliced mRNA.
    [151] Northern analysis was carried out using a third fragment obtained from clone 19A2 spanning 2000 to 3100 nucleotides of SEQ ID NO: 1, and the results were in agreement with those of other clone 19A2 fragments.
    [152] RNA from three myeloid cell lines was also probed using fragments corresponding to nucleotides 500-2100 and 2000-3100 of SEQ ID NO: 1. The THP-1 cell line, previously stimulated with PMA, showed a spreading signal in the same size range (about 5 kb), which was slightly stronger than the tissue signal. RNA from unstimulated and DMSO-stimulated HL-60 cells hybridized with α d probes at the same intensity as in tissue samples, which is believed to increase signal strength due to PMA treatment. Since PMA and DMSO differentiate HL-60 cells into monocyte / macrophage and granulocyte pathways respectively, these results suggest that α d expression in monocyte / macrophage type is enhanced. U937 cells express α d messages so that this signal does not enhance PMA stimulation. No bands were observed in Molt, Daudi, H9, JY or Jurkat cells.
    [153] Example 7
    [154] Human α dTransient manifestation of constituents
    [155] Human clone 19A2 is missing a portion of the initiating methionine codon and 5 'signal sequence. Thus, two different techniques were used to generate human expression plasmids comprising the 19A2 sequence. First, two plasmids were constructed such that signal peptide sequences derived from the gene encoding CD11b or CD11c were spliced into clone 19A2 to form a chimeric α d sequence. Second, an adenosine base was added at position 0 of clone 19A2 to construct a third plasmid to encode the onset of methionine.
    [156] Three plasmids contained different regions encoding the 5 'portion of the α d sequence or chimeric α d sequence. The α d region was PCR amplified using a specific 3 'primer BamRev (shown below in SEQ ID NO: 26) and one of three 5' primers (see Example 2 for conditions). The three 5 'primers included the following in the sequence. (1) the same nonspecific base at cleavable positions 1-6, EcoRI position derived from positions 7-12 and consensus Kozak sequence derived from positions 13-18; (2) a portion of a CD11b (primer ER1B) or CD11c (primer ERC1) signal sequence, or adenosine (primer ER1D); And (3) 15 to 17 additional bases that specifically overlap the 5 'sequence obtained from clone 19A2 to anneal the primer. Primers ER1B, ER1C or ER1D are shown in SEQ ID NOs: 27, 28 or 29, respectively, and these sequences are underlined with the initiating methionine codons and the EcoRI position is underlined in double.
    [157] (SEQ ID NO 26)
    [158] (SEQ ID NO 27)
    [159] (SEQ ID NO 28)
    [160] (SEQ ID NO 29)
    [161] The resulting PCR product was digested with EcoRI and BamHI.
    [162] All three plasmids included a common second α d region (inserted immediately downstream from the 5 ′ region described in the previous paragraph), including the 3 ′ end of the α d clone. A second α d region extending from nucleotide 625 in the vector 3 ′ polylinker region of clone 19A2 to the XbaI position was isolated by digesting clone 19A2 with BamHI and XbaI.
    [163] Three ligation reactions in which the 3 'α d BamHI / XbaI fragment was ligated to any of the three 5' α d EcoRI / BamHI fragments were prepared using Boehringer Mannheim's ligase buffer and T4 ligase (1 unit per reaction). It was. After 4 hours of incubation at 14 ° C., an appropriate amount of vector pcDNA.3 (Invitrogen) digested with EcoRI and XbaI was added to each reaction with an additional unit of ligase. The reaction was continued for another 14 hours. One tenth of the reaction mixture was then transformed into soluble XL-1 Blue cells. The resulting colonies were cultured to separate DNA as in Example 5. Decomposition with EcoRI confirmed three colonies positive at the restriction site, thereby manipulating the signal sequence. The clones were named pATM.B1 (CD11b / α d , obtained from primer ER1B), pATM.C10 (CD11c / α d , obtained from primer ER1C) and pATM.D12 (adenosine / α d , obtained from primer ER1d). . The presence of the appropriate signal sequence in each clone was demonstrated by nucleic acid sequencing.
    [164] Expression from the above α d plasmids was carried out by cotransfection of COS cells with respective plasmids and CD18 expression plasmid, pRC.CD18. As a positive control, COS cells were also cotransfected with the plasmids pRC.CD18 and CD11a expressing plasmid, pDC.CD11A.
    [165] Cells cultured in culture medium (DMEM / 10% FBS / Pen-Strep) were transferred to a 10 cm tissue culture treated Petri dish at 50% confluence 16 hours prior to transfection. Cells were isolated from the plates using Versene buffer (0.5 mM NaEDTA in PBS) for all procedures without trypsin. Prior to transfection. The plates were washed once with serum free DMEM. 15 μg of each plasmid was added to 5 mL of transfection buffer (DMEM containing 20 μg / mL DEAE-dextran and 0.5 mM chloroquinone) on each plate. After 1.5 hours of incubation at 37 ° C., the cells were shocked using DMEM / 10% DMSO for 1 minute. The DMSO solution was then replaced with 10 mL / plate culture medium.
    [166] As described in Examples 8, 9 and 10, the resulting transfectants were analyzed by ELISA, FACS and immunoprecipitation.
    [167] Example 8
    [168] ELISA assay for COS transfectants
    [169] Order with respect to CD18 to determine whether the co-transfected COS cells with the CD18 expression plasmid pRC.CD18 and an α d plasmid expressed α d on the cell surface, the primary antibody was generated against the CD18 (for example, ATCC HB203 ELISA was performed using TS1 / 18 obtained from. As a positive control, ELISA was also performed on co-transfected cells with CD18 expressing plasmid and CD11a expressing plasmid, pDC.CD11A. Primary antibodies in the control group included CD18 antibody and anti-CD11a antibody (eg TS1 / 22 obtained from ATCC HB202).
    [170] For ELISA, cells from each plate were separated using Versene buffer and transferred to a single 96 well flat bottom Corning tissue culture plate. Cells were incubated in culture medium two days before the assay. This plate was then washed twice with 150 μl / well D-PBS / 0.5% teleost skin gelatin (Sigma) solution. This buffer was used for all steps except growth. All cleaning and incubation procedures were performed at room temperature. The wells were blocked for 1 hour with gelatin solution. The primary antibody was diluted to 10 μg / ml in gelatin solution and then 50 μl was added to each well. Three wells were set up for each primary antibody. After 1 hour of incubation, the plates were washed three times with 150 μl / well gelatin solution. Secondary antibodies of 1: 3500 dilution (goat antimouse Ig / HRP-Fc specific [Jackson, Pennsylvania]) were added at a concentration of 50 μl / well and the plates were incubated for 1 hour. After three washes, the plate was plated with 100 μl / well of o-phenyldiamine (OPD) (Sigma) solution (1 mg / ml OPD in citrate buffer) before adding 50 μl / well of 15% sulfuric acid. Developed for minutes.
    [171] Analysis of the transfectants in ELISA format using anti-CD18 specific antibodies revealed little expression beyond the background of cells transfected with plasmid encoding CD18 alone. Cells co-transfected with plasmids containing CD11a and CD18 were found to have increased expression compared to the background when analyzed using CD18 specific antibodies or reagents specific for CD11a. Further analysis of the co-transfected cells with one of the plasmids encoding the CD18 and one of the α d expression constructs (pATM.C10 or pATM.D12) showed that the cell surface expression of CD18 was concomitantly recovered following the expression of α d . there was. The increase in detectable CD18 expression in COS cells transfected with pATM.C10 or pATM.D12 was comparable to cotransfected CD11a / CD18 positive control cells.
    [172] Example 9
    [173] FACS analysis of COS transfectants
    [174] In FACS assay, cells in Petri dishes were transfected and then cultured with fresh culture medium and incubated 2 days prior to analysis. Transfectant cells were separated from the plate using 3 ml of Versene, washed once with 5 ml FACS buffer (DMEM / 2% FBS / 0.2% sodium azide), and then 500,000 cells / sample in 0.1 ml FACS buffer. Diluted to a concentration of. Either 1 mg / ml of FITC-conjugated CD18, CD11a or CD11b specific antibodies (Becton Dickinson) or 800 μg / ml of CFSE-conjugated murine 23F2G (anti-CD18) (ATCC HB11081) 800 μg / ml 10 μl was added to each sample. Samples were then incubated on ice for 45 minutes, washed three times with 5 ml / wash of FACS buffer and resuspended in 0.2 ml of FACS buffer. Samples were processed on a Becton Dickinson FACscan and the data analyzed using Lysys II software (Becton Dickinson).
    [175] COS cells transfected with the CD18 sequence alone were not stained for CD18, CD11a or CD11b. When cotransfected with CD11a / CD18, about 15% of the cells were stained with an antibody against CD18 or CD11a. All cells transfected with CD18 and any α d construct were stained detectably for CD11a and CD11b. pATM.B1, pATM.C10 and pATM.D12 groups stained 4%, 13% and 8% positive for CD18, respectively. The fluorescence of the positive population in the CD11a / CD18 group was four times higher than the background. In contrast, co-transfection of the α d construct and the CD18 construct showed a 4-7 fold increase in fluorescence intensity relative to the background.
    [176] Example 10
    [177] Human α obtained from co-transfected COS cells dBiotin-labeled immunoprecipitation of CD18 complex
    [178] To determine whether a d can be isolated as part of a beta heterodimeric complex that characterizes integrins, immunoprecipitation was performed on cells co-transfected with CD18 and on each a d expression plasmid as described in Example 7. Was performed.
    [179] Transfected cells (1-3 × 10 8 cells / group) were isolated from Petri dishes using Versene buffer and washed three times in 50 ml / group D-PBS. Each sample was labeled with 2 mg of sulfo-NHS biotin (Pierce, Rockford, Ill.) At room temperature for 15 minutes. The reaction was quenched by washing three times in 50 mL / sample of cold D-PBS. The washed cells are resuspended in 1 ml lysis buffer (1% NP40, 50 mM Tris-HCl, pH 8.0, 0.2 M NaCl, 2 mM Ca ++ , 2 mM Mg ++ and protease inhibitors) and 15 on ice Incubated for minutes. Insoluble material was pelleted by centrifugation at 10,000 g for 5 minutes, and the supernatant was poured into a new tube. In order to remove substances that are not specifically reactive with mouse immunoglobulins, a preclearance step was first performed. 25 μg of mouse immunoglobulin (Cappel, West Chester, PA) was incubated with supernatant at 4 ° C. After 2.5 hours, 100 μl (25 μg) rabbit anti mouse Ig conjugated Sepharose® (produced with Protein A Sepharose® 4B and rabbit anti mouse IgG, all obtained from Zymed, San Francisco, California) Is added to each sample; Incubation was continued at 4 ° C. with shaking for 16 hours. Sepharose® beads were separated from the supernatant by centrifugation. After preclearance, the supernatants were treated with 20 μg antiCD18 antibody (TS1.18) at 4 ° C. for 2 hours. Antibody / antigen complexes were isolated from the supernatants by incubation with the 100 μL / sample rabbit antimouse / protein A-Sepharose® preparation described above. Beads were washed four times with 10 mM HEPES, 0.2 M NaCl and 1% Triton-X 100®. Washed beads were pelleted and boiled over 10 minutes with 2% β-mercaptoethanol in 20 μl 2 × Laemmli sample buffer. The samples were centrifuged and run for 30 minutes at 100 V on prepoured 8% Novex polyacrylamide gels (Novex). Proteins were transferred to nitrocellulose membranes (Schleicher & Schuell) in TBS-T buffer at 200 mAmps for 1 hour. The membrane was blocked with 3% BSA in TBS-T for 2 hours. The membrane was treated with strep-amidine hose radish peroxidase (POD) [Boehringer Mannheim] at 1: 6000 dilution for 1 hour and then washed three times in TBS-T. The blot was then developed using the Amersham Enhanced Chemiluminescence Kit according to the manufacturer's instructions. The membranes were exposed to Hyperfilm® MP (Amersham) for 0.5-2 hours.
    [180] Immunoprecipitation of CD18 complexes obtained from cells transfected with any of pRC.CD18 and pATM.B1, pATM.C10 or pATM.D12 results in about 100 kD β chains corresponding to the expected size of CD18 and about α d It was found that heterodimer species consisting of 150 kD α chains were surface-expressed.
    [181] Example 11
    [182] Human α in Chinese Hamster Ovary Cells dStable Transfection of
    [183] To determine whether α d was expressed on the cell surface as a heterodimer bound to CD18, all cDNAs encoding each chain were transiently and stably transfected into cell lines free of α d and CD18.
    [184] For this experiment, α d cDNA was amplified with additional leader sequence and Kozak consensus sequence as described in Example 7, and subcloned into expression vector pcDNA3. pATM.D12 termed the final composition, a modified commercially available vector encoding the human CD18, with pDC1.CD18 dihydro folate reductase (DHFR) - Chinese hamster ovary (CHO) cells were transfected by co-infection. Plasmid pDC1.CD18 encodes a DHFR + marker and the transfectants can be selected using appropriate nucleoside-deficient media. A modification method to generate pDC1.CD18 is as follows.
    [185] Plasmid pRC / CMV (Invitrogen) is a mammalian expression vector carrying a cytomegalovirus promoter and ampicillin resistance marker gene. The DHFR gene obtained from plasmid pSC1190-DHFR was inserted at pRC / CMV 5 ′ at the point of origin of SV40 replication. In addition, the polylinker obtained from the 5 'region of the plasmid pHF2G-DHF was ligated with the pRC / CMV / DHFR construct, 3' of the DHFR gene. The CD18 coding sequence is then cloned between the 5 'flanking polylinker region and the bovine growth hormone poly A coding region of the resulting plasmid.
    [186] Surface expression of CD18 is analyzed by flow cytometry using the monoclonal antibody TS1 / 18. The heterodimer formation detected between α d and CD18 of this cell line is consistent with immunoprecipitation by transient expression in COS cells described in Example 10.
    [187] Example 12
    [188] Human α dCombines with ICAM-R in a CD18-dependent manner
    [189] Reports demonstrating the interaction between leukocyte integrins and intracellular adhesion molecules (ICAM) that mediate cell-cell contact [Hynes, Cell 69: 11-25 (1992)], CHO cells expressing α d / CD18. The ability to bind ICAM-1, ICAM-R or VCAM-1 is assessed in two ways.
    [190] In a dual assay, soluble ICAM-1, ICAM-R, or VCAM-1 IgG1 fusion proteins were immobilized on plastic and the ability of α d / CD18 CHO transfected cells to bind immobilized ligand was determined. Transfected cells were internally labeled with calcein and washed in binding buffer (RPM with 1% BSA), followed by 10 μg / of pure buffer (with or without 10 ng / ml PMA) or antiCD18 monoclonal antibody. Incubated in ml containing buffer. The transfected cells were previously coated with soluble ICAM-1 / IgG1, ICAM-R / IgG1 or VCAM-1 / IgG1 fusion proteins, or bovine serum albumin (BSA) as a negative control, 96-well Emlon® 4 It was added to the microtiter plate. The design of the soluble forms of such attachment molecules is described in U.S. Patent Application Serial No. 08 / 102,852, filed August 5, 1993, and in co-pending and co-pending applications and is fully disclosed. Wells were blocked with 1% BSA in PBS before adding labeled cells. After washing the plate by immersing in PBS containing 0.1% BSA for 20 minutes, the total fluorescence remaining in each well was measured using Cytofluor® 2300 (Millip, Mass., Mass.).
    [191] In experiments with immobilized ICAM, it was found that α d / CD18 cotransfectants bound 3 to 5 times more to ICAM-R / IgG1 wells as compared to BSA coated wells. The specificity and CD18-dependency of this binding was demonstrated by the inhibitory effect of the anti-CD18 antibody TS1 / 18. The binding of cells transfected with CD11a / CD18 to ICAM-1 / IgG1 wells was comparable to the binding observed in BSA coated wells. The binding of CD11a / CD18 transfected cells to ICAM-1 / IgG1 wells after PMA pretreatment was found to be increased 2-3 fold. PMA treatment of the α d / CD18 transfectants did not affect binding to ICAM-1 / IgG1 or ICAM-R / IgG1 wells. No detectable binding of α d / CD18 transfectants to VCAM-1 / IgG1 wells was observed.
    [192] Binding of α d / CD18 transfected cells to soluble ICAM-1 / IgG1, ICAM-R / IgG1 or VCAM-1 / IgG1 fusion proteins was determined by flow cytometry. About 1 million α d / CD18 transfected CHO cells (grown in spinner flasks for higher expression) per dose, with or without 10 μg / ml anti-CD18 antibody (RPMI and 1 % BSA). After incubation for 20 minutes at room temperature, cells were washed in binding buffer and soluble ICAM-1 / IgG1 or ICAM-R / IgG1 fusion proteins were added to a final concentration of 5 μg / ml. Binding was performed at 37 ° C. for 30 minutes, and then the cells were washed three times and resuspended in 100 μl of binding buffer containing FITC-conjugated anti-human IgG1 at a dilution of 1: 100. After incubation for 30 minutes, the samples were washed three times and suspended in 200 μl of binding buffer for analysis using Becton Dickinson FACscan.
    [193] About 40-50% of the α d / CD18 transfectants were shown to bind to ICAM-R / IgG1, but not to ICAM-1 / IgG1 or VCAM / IgG1 proteins. Pretreatment of the transfected cells with PMA did not affect the binding of ICAM-1 / IgG1, ICAM-R / IgG1 or VCAM-1 / IgG1 with α d / CD18, which is consistent with the immobilization attachment assay. After treatment of α d / CD18 transfectants with anti-CD18 antibody TS1 / 18, binding by ICAM-R was reduced to background levels.
    [194] The data obtained from these two binding assays illustrate that α d / CD18 binds to ICAM-R more favorably than ICAM-1 and VCAM-1. The α d / CD18 binding preference for ICAM-R relative to ICAM-1 was the opposite of that observed for CD11a / CD18 and CD11b / CD18. Modulation of α d / CD18 binding can predict that ICAM-R selectively affects normal and pathological immune function, which plays an important role. Moreover, the results of similar assays in which immunospecific antibodies against various extracellular domains of ICAM-R were tested for the ability of ICAM-R to bind α d / CD18 transformants showed that α d / CD18 and CD11a / CD18. It suggests that it interacts with different domains of ICAM-R.
    [195] The failure of CD11a / CD18 in solution to bind to ICAM-1 / IgG1 or ICAM-R / IgG1 is due to a too low binding affinity between CD11a / CD18 and ICAM-1 or ICAM-R, which does not allow binding in solution. To present. However, detection of binding of ICAM-R / IgG1 and α d / CD18 suggests a particularly high binding affinity.
    [196] In the above assay, the VCAM-1 / Ig fusion protein contained seven extracellular immunoglobulin-like domains. The fusion protein was prepared in transfected CHO cells and protein yield was determined by sandwich ELISA. Seven domain VCAM-1 fusion proteins obtained from CHO cell supernatants were used without purification, in which case the protein yield was found to be very low. Due to the low protein yield in the VCAM-1 preparation, a commercially available VCAM-1 preparation (R & D Systems, Minneapolis, Minnesota), to determine whether a low VCAM-1 concentration makes it impossible to detect α d binding Was used again to observe the binding of α d / CD18 and VCAM-1.
    [197] As before, CHO cells expressing α d and CD18 were used in attachment assays using immobilized recombinant attachment molecules. Results of the flow cytometry, α d - CHO cells transfected were able to express both α d and CD18, and found that other β 2 integrin has not expressed. The transfected CHO cells were also found to express none of the two known VCAM-1 binding partner proteins, α 4 β 1 and α 4 β 7 . Parental CHO cell lines were found not to express either α 4 or β 2 integrins. Binding experiments were performed substantially the same as described above.
    [198] As a result, the α d -transfected CHO cells bound 7.5% to the immobilized BSA and 2.8% to the immobilized E-selector, about 14.2% to the immobilized VCAM-1. It can be seen that combined. Moreover, immobilized VCAM-1 was essentially blocked (3.0% binding) in the presence of monoclonal antibodies specific for the first domain of VCAM-1. Parental CHO cells did not bind to any of VCAM-1, E-selector or BSA (binding ratio in all cases was less than 2%). Binding of transfected CHO cells also decreased with successive passages, consistent with the observed decrease in α d surface expression over the same time period.
    [199] Peripheral blood eosinophils were isolated to determine whether cells originally expressing α d / CD18 use VCAM-1 as binding partner, and 5 in the presence of 10 ng / ml IL-5 to increase α d expression. Incubated for ˜7 days. Through flow cytometry, IL-5 incubation increased α d expression 2-4 times, but did not express α 4 .
    [200] Through the results, cultured eosinophils bind to immobilized VCAM-1 at a rate of about 28.8% and binding is anti-CD18 monoclonal antibody (binding ratio 17.1%) and monoclonal antibody to α 4 (binding ratio 18.1 %) Was partially suppressed. In contrast to the aforementioned preliminary results of low levels and / or impure VCAM-1, this data indicates that α d β d is a ligand for VCAM-1.
    [201] The FACS attachment assay described above was used to test the binding of CHO cells with ICAM-R mutant E37A / Ig expressing α d / CD18. E37A / Ig appears to be defective in binding to LFA-1 / Ig chimeras (Sadhu et al., Cell Adhesion and Communication 2: 429-440 (1994)). Mutant proteins were expressed in soluble form from stably transfected CHO cell lines and purified on Procep® A columns [Sadhu et al., Homologous].
    [202] α d / CD18 transformants and E37A / Ig binding were not detected in the repeated assays. The mean fluorescence intensity (MFI) of the E37A / Ig chimeras detected by the FITC-conjugated anti-human antibody was the same as the MFI of the detection antibody alone, indicating that abnormal signals were detected when using the E37A / Ig mutant protein in the assay. It suggests that it cannot be. Similarly, in the ELISA performed as described in Example 14, the E37A / Ig mutant did not appear to bind with immobilized α d / CD18.
    [203] α dBinding to iC3b
    [204] Supplementary component C3 is proteolytically cleaved to form complex iC3b, which initiates an alternative pathway of supplemental activation, ultimately leading to cell mediated destruction of the target. CD11b and CD11c are both involved in iC3b binding and in later phagocytosis of iC3b coated particles. Peptide fragments of the CD11b I domain have recently been identified as the site of iC3b interaction (Ueda et al., Proc. Natl. Acad. Sci (USA) 91: 10680-10684 (1994)). iC3b binding regions are highly conserved in CD11b, CD11c and α d , suggesting α d / iC3b binding interaction.
    [205] Binding of iC3b to α d is performed using a transfectant or a cell line expressing native α d (eg, PMA-stimulated HL60 cells) and iC3b coated sheep erythrocytes (sRBC) [Dana et al. , J. Clin. Invest. 73: 153-159 (1984). The ability of α d / CD18 CHO transfectants, VLA4-CHO transfectants (negative control) and PMA-stimulated HL60 cells (positive control) to form rosettes is characterized by anti-CD18 monoclonal antibodies (eg TS1 / 18.1) In the presence and absence of.
    [206] Example 13
    [207] α dScreening by Scintillation Proximity Assay ID of Modulators of Binding
    [208] Specific binding inhibition between α d ligands of the present invention and their binding partners (α d ligand / antiligand pairs) is described in US Pat. No. 4,271,139, Hart and Greenwald, Mol. Immunol. 12: 265-267 (1979), And Hart and Greenwald, J. Nuc. Med. 20: 1062-1065 (1979), each of which is incorporated herein by reference, which may be determined by a number of means, such as scintillation proximity analysis techniques.
    [209] In short, members of the α d ligand / antiligand pair are bound directly or indirectly on a solid support. Indirect collection involves monoclonal antibodies that bind directly on the support, which recognizes specific epitopes at the C-terminus of the soluble integrin β chain protein. This epitope may be a hemagglutinin protein or a mycobacterial IIIE9 epitope (Anderson et al., J. Immunol. 141: 607-613 (1988)). The fluorescent agent also binds to the support. Alternatively, the fluorescent agent can be incorporated into a solid support as described in US Pat. No. 4,568,649 (incorporated herein by reference). The unsupported binding member of the α d ligand / antiligand pair is labeled with a radioactive compound that emits radiation that can excite the fluorescent agent. When the ligand binds to a radiolabeled antiligand, the label binds in close proximity to the support binding fluorescent agent to excite the fluorescent agent, resulting in light emission. If not bound, the label is generally far away from the solid support to excite the fluorescent agent, so the emissivity of the light is low. The emitted light is measured, which correlates with the bond between the ligand and the antiligand. If a binding inhibitor is added to the sample, the fluorescence emissivity will decrease so that the radiolabel is not captured in the vicinity of the solid support. Thus, binding inhibitors can be identified by the effect on fluorescence emission from their samples. Potential antiligands for α d can also be identified in a similar manner.
    [210] Soluble recombinant α d / CD18 leucine zipper construct (see Example 14) is used in the scintillation proximity assay to screen for CAM binding modulators according to the following method. Recombinant integrins are immobilized with non-blocking anti α subunit or anti β subunit antibodies previously coated on the scintillant embedded plate. Chemical library compounds and specific biotinylated CAM / Ig chimeras are added to this plate at the same time. Binding of CAM / Ig chimeras is detected by labeled streptavidin. In the assay, ICAM-1 / Ig and ICAM-R / Ig are biotinylated with NHS-sulfo-biotin LC (long chain, Pierce) according to the protocol proposed by the manufacturer. Labeled proteins react with CAM specific antibodies, which can be seen to react with immobilized LFA-1 by ELISA, detection by subsequent development using streptavidin-HRP and OPD.
    [211] Alternatively, the recombinant leucine zipper protein is purified, or partially purified, and coated directly onto the scintillant embedded plate. Unlabeled CAM / Ig chimeric and chemical library compounds are added simultaneously. Bound CAM / Ig is detected as 125 I-labeled antihuman Ig.
    [212] As another method, purified CAM / Ig protein is immobilized on the scintillant plate. Chemical library compounds and concentrated supernatants obtained from cells expressing the prepared leucine zipper integrins are added to the plate. Binding of recombinant integrins is detected with labeled, nonblocking α or β subunit antibodies.
    [213] Screening for Small Molecule Modulators
    [214] As an alternative to scintillation proximity assays, α d binding partners and inhibitors thereof can be identified by ELISA-like assays as described below.
    [215] Soluble α d / CD18 leucine zipper (LZ) constructs (see Example 14) were collected from tissue culture supernatants using anti α d antibody 212D (see Example 15). 212D antibody was immobilized on 96 well emulon® IV plates (Costar) overnight in 4 ° C. bicarbonate coating buffer, pH 9.5. The anti-CD11a antibody TS2 / 4.1 was immobilized using the same method to immobilize the LFA-1 leucine zipper (LFA-1LZ) fusion protein; In this case, LFA-1 was used as a negative control for VCAM-1 binding and a positive control for ICAM-1 binding. This plate was blocked with 300 μl / well of 3% bovine serum albumin for 1 hour and washed in D-PBS. Tissue culture supernatants obtained from stable CHO transfectants expressing α d / CD8LZ or LFA-1LZ were added at a concentration of 100 μl / well and incubated at 4 ° C. for 6-8 hours. This plate was washed twice with Tris-buffered saline containing Tween 20 (TBS-T), and then TBS (Tween®) containing 2 mM calcium chloride, magnesium chloride and manganese chloride, respectively. Not washed) once. The latter is used as assay and wash buffer throughout the assay.
    [216] After integrins were collected, these plates were washed three times with 250 μl / well TBS. Purified CAM / Ig (see Example 12) was added to each well, followed by dilution at a continuous 2: 3 dilution starting from 10-20 μg / ml concentration. CAM / Ig was bound at room temperature for 2 hours prior to washing the plate as described above. The bound fusion protein was detected with horse radish peroxidase conjugated goat-human Ig antibody (Jackson Labs) and then developed with o-phenyldiamine (OPD).
    [217] From the results, it can be seen that the binding to LFA-1LZ did not bind to α d / CD18LZ when ICAM-1 / Ig increased the signal 5-7 times. In contrast, VCAM-1 / Ig showed a 5 fold increase in signal in wells containing α d / CD18LZ, but not in wells containing LFA-1LZ. ICAM-R mutant E37A / Ig (see Example 12) did not bind to either of the integrins.
    [218] α d specific monoclonal antibodies 212D, 217L, 217I, 217H, 217G, 217K and 217M were tested for their ability to bind α d / CD18 immobilized with VCAM-1. In addition, reaction specificity was determined using anti-VCAM-1 monoclonal antibodies 130K, 130P and IG11B1 (Caltag). 5 μg / ml antiα d monoclonal antibody and 25 μg / ml antiVCAM-1 antibody were used; Higher concentrations of anti-VCAM-1 antibodies were used given the fact that VCAM-1 was present in solution in the assay system.
    [219] Partial blocking (50%) resulted in wells that were treated with 217I or with 130K and 130P together. The 130K / 130P combination also completely inhibits the interaction of VLA-4 and VCAM-1, which is because α d and VLA-4 bind to specific positions on VCAM-1, resulting in α d / VCAM-1 binding. This suggests the possibility of developing agonists that selectively interfere.
    [220] This assay can be applied as follows to perform high throughput screening assays for inhibitors of α d binding. ICAM-1 / Ig is biotinylated and used in the presence of a pooled chemical compound dissolved in DMSO as described above; Bound VCAM-1 / Ig is then detected using Streptavidin-Europium (Eu) complex. The streptavidin-Eu complex is activated by chelation to emit measurable light. Changes or more specifically reductions in the emission of light are indicative of inhibition of VCAM-1 / α d binding, which is probably the result of the action of one or more compounds in small molecule pools, and then individually or in smaller groups. Is analyzed in.
    [221] Example 14
    [222] Soluble human α dExpression construct
    [223] Expression of the full-length, soluble human α d / CD18 heterodimeric protein provides an easily purified material for immobilization and binding assays. Soluble protein production methods are advantageous in that they can be purified from the supernatant rather than from cell lysates (containing full length membrane binding α d / CD18); In this case, recovery is improved and impurities are reduced.
    [224] Soluble α d expression plasmids were constructed as follows. The nucleotide fragment corresponding to the region derived from bases 0 to 3191 of SEQ ID NO: 1 cloned into plasmid pATM.D12 was isolated by digestion with HindIII and AatII. PCR fragments corresponding to bases 3130 to 3390 of SEQ ID NO: 1, which overlap with the HindIII / AatII fragment and whose MluI restriction position is added to the 3 'end, are represented by the primers sHAD.5 and sHAD.3 shown in SEQ ID NOs: 30 and 31, respectively. Was amplified from pATM.D12.
    [225] 5'-TTGCTGACTGCCTGCAGTTC-3 '(SEQ ID NO: 30)
    [226] 5'-GTTCTGACGCGTAATGGCATTGTAGACCTCGTCTTC-3 '(SEQ ID NO: 31)
    [227] PCR amplification products were digested with AatII and MluI and ligated to HindIII / AatII fragments. The resulting product was ligated to HindIII / MluI-digested plasmid pDC1.s.
    [228] This construct was co-expressed with soluble CD18 in stably transfected CHO cells and expression was confirmed by radiographic visualization of immunoprecipitated CD18 complexes derived from 35 S-methionine labeled cells. This construct is also co-expressed with CD18 in 293 cells [Berman et al., J. Cell. Biochem. 52: 183-195 (1993).
    [229] Fusible battlefield α dedifice
    [230] Alternative α d expression constructs are also contemplated by the present invention. In order to facilitate the expression and purification of the original α d / CD18 heterodimer, the soluble α d and CD18 expression plasmids are thought to contain a “leucine zipper” fusion sequence that stabilizes the heterodimer during purification [Chang et al., Proc. Natl. Acad. Sci (USA), 91: 11408-11412 (1994). In short, DNA encoding the acidic and basic amino acid strands of the zipper was generated by primer annealing using oligonucleotides described in Chang et al. The DNA sequence is further modified to include additional MluI and XbaI restriction positions at the 5 'and 3' terminal positions of the DNA, respectively, to facilitate subcloning into the α d or CD18 expression construct as described above. In addition, sequences representing hematoglutinin protein or polyhistidine sequences are inserted and the stop codon is inserted after the XbaI position. Hemagglutinin or polyhistidine sequences are incorporated to facilitate affinity purification of the expressed protein. The sequence encoding the base chain of the zipper is incorporated into a plasmid vector expressing CD18; Acid strands are inserted into the α chain construct. As the modified α d and CD18 proteins are expressed in host cells, the interaction between the acidic and basic chains of the zipper structure will stabilize the heterodimer and the original α d / CD18 by affinity purification as described above. Allow the molecules to separate.
    [231] Plasmids were constructed for the expression of soluble α d and CD18 bearing acidic and basic “leucine zipper” sequences by the DEAE / dextran method described in Example 7, and transfected with COS cells. The resulting protein was called α d / CD18LZ. Hemagglutinin and polyhistidine tags were not incorporated into the α d / CD18 LZ. Transfected cells were grown under reducing serum (2%) conditions for 14 days. Supernatants collected every 5 days from transfected cells were analyzed for protein production by ELISA as described in Example 8. In brief, α d / CD18 LZ heterodimer was immobilized on a plate coated with anti α d monoclonal antibody 169B (see Example 15). Biotinylated anti-CD18 monoclonal antibody, TS1 / 18.1 (see Example 18), was added to detect the α d / CD18 LZ complex, followed by streptavidin / hose radish peroxidase (HRP) conjugates and o -Phenyldiamine (OPD) was added. Protein was clearly detected in the supernatant.
    [232] Fusible battlefield α dBinding Assays Using Expression Products
    [233] Functional binding assays using soluble full-length α d / CD18LZ heterodimers as described above were performed by immobilizing heterodimers on plates coated with monoclonal antibody 169B or unblocking anti-CD18 monoclonal antibody (Example 15 Reference). The wells were blocked with fish skin gelatin to prevent nonspecific binding prior to addition of the CAM / Ig chimera (see Example 12) at an initial concentration of 10 μg / ml. The goat-antihuman Ig HRP conjugate (Jackson Labs) was used to confirm the binding of the chimera with α d / CD18LZ and developed with OPD.
    [234] VCAM-1 / Ig was observed to bind 3 to 5 times higher levels of the captured α d / CD18LZ than captured CD11a / CD18. ICAM-1 / Ig and ICAM-2 / Ig bound to soluble CD11a / CD18 heterodimer, respectively, at approximately 10-15 times or more of background, but not α d / CD18. VCAM-1 binding was reduced by approximately 50% in the presence of VCAM-1 specific antibodies 130K and 130P used in combination.
    [235] Binding assays were also performed by immobilizing ICAM / Ig proteins on 96 well plates and then adding recombinant soluble integrins in the cell supernatant. Binding of soluble integrins was performed using unlabeled nonblocking α or β subunit specific murine antibodies, incubated with HRP-conjugated goat anti-mouse antibody and run with OPD.
    [236] The results showed that the binding of the non-blocking antibody detected as α d / CD18LZ to bind to ICAM-R / Ig was 10 times stronger than the binding detected in the control wells containing no antibody. Soluble α d / CD18 binding was not detected when using immobilized ICAM-1 / Ig, but the binding detected between α d / CD18 and immobilized CD11b / CD18 and CD11a / CD18 was 5 to 5 than for background binding, respectively. 15 times bigger.
    [237] Previous studies have demonstrated that CD11b and CD11c bind lipopolysaccharide (LPS) [Wright, Curr. Opin. Immunol. 3: 83-90 (1991); Ingalls and Golenbock, J. Exp. Med. 181: 1473-1479 (1995)], binding of α d / CD18 and LPS was also assessed using flow cytometry and platelet assay. As a result, S. Minnesota (S.Minnesota) and S. T fossa (S.typhosa) is separated from (all available from Sigma), FITC- labeled LPS is 20 ㎍ / ㎖ in infected α d / CD18 transfected CHO It was found that the cells can bind weakly. No binding was detected in control CHO cells that were not transfected. In the ELISA format assay, 0.5-3.0 μg of biotinylated LPS [Luk et al., Alan. Biochem. 232: 217-224 (1995)] immobilized the signal 4 times higher than with captured antibody and blocking reagent alone. Bound α d / CD18LZ. The apparent binding of LPS and CD11a / CD18 was reduced by subtracting background binding to the anti-CD11a antibody TS2 / 4 from each experiment.
    [238] To identify other ligands for α d / CD18, recombinant α d / CD18LZ protein is used in a dual study mode. Binding of various cell types to immobilized proteins is used to determine which cells express α d ligands on the cell surface. Antibody inhibition is then used to determine whether cell binding due to interaction with known surface adhesion molecules is observed. If suppression does not occur, the co-immunoprecipitation with α d / CD18LZ bound to proteins derived from lysates of cells to be combined with the α d is used to to identify the ligand.
    [239] Soluble human α dI domain expression constructs
    [240] It has already been reported that the domain I in CD11a can be expressed independently of structural units that maintain ligand binding capacity and antibody recognition [Randi and Hogg, J. Biol. Chem. 269: 12395-12398 (1994); Zhout et al., J. Biol. Chem. 269: 17075-17079 (1994); Michishita et al., Cell 72: 857-867 (1993). To generate soluble fusion proteins comprising the α d I domain and human IgG4, the α d I domain is amplified by PCR using primers designed to be inserted at the flanking BamHI and XhoI restriction sites to facilitate subcloning . Son primers are set forth below in SEQ ID NOs: 32 and 33, where the restriction sites are underlined.
    [241] (SEQ ID NO 32)
    [242] (SEQ ID NO: 33)
    [243] The C nucleotide is located directly 3 'to the BamHI position of SEQ ID NO: 32, which corresponds to 435 nucleotide of SEQ ID NO: 1; The G nucleotide on the 3 'side of the XhoI position of SEQ ID NO: 33 is complementary to nucleotide 1067 of SEQ ID NO: 1. The amplified I domain is digested with a suitable enzyme and the purified fragment is ligated to pDCs, a mammalian expression vector and pGEX-4T-3 (Pharmacia), a prokaryotic expression vector, and then the fragment I is sequenced. The fusion protein is then expressed in COS, CHO or E. Coli cells that have been transfected or transformed with the appropriate expression construct.
    [244] For a given affinity of α d for ICAM-R, the expression of α d I domain is sufficiently affinity, which may be a useful inhibitor of cell adhesion involving α d .
    [245] Human α dAnalysis of ⅠDomain / IgG4 Fusion Proteins
    [246] Proteins were analyzed by SDS-PAGE under reducing conditions and non-reducing conditions and visualized by silver staining or Comash staining. The protein was then transferred to an immunobinone PVDF membrane and Western blot analysis was performed using anti-human IgG monoclonal antibodies or anti-Ig monoclonal antibodies.
    [247] The detected protein was found to move up to about 120 kD under non-reducing conditions and to 45 kD under reducing conditions. Minor bands were also detected at about 40-50 kD positions on non-reducing gels, which were reactive with anti-human antibodies but not with the blood serum. The minor band of 200 kD was confirmed to be small by Western blot.
    [248] Binding Assay Using Domain I Product Expression
    [249] The ability of domain I to specifically recognize ICAM-R / IgG chimeric proteins was tested in ELISA format. α d Ⅰ a series of dilutions of the TBS domain IgG4 fusion protein (Iα d / IgG4) were incubated with ICAM-1 / IgG, ICAM- R / IgG and the VCAM-1 / IgG, or unrelated IgG1 myeloma Proteins were immobilized on emulon® IV RIA / EIA plates. CD11a I domain / IgG chimeric protein and human IgG4 / kappa myeloma protein were used as negative controls. IgG4 bound with the biotinylated anti-IgG4 monoclonal antibody HP6023 was detected and then streptavidin-peroxidase conjugate was added and developed using the substrate o-phenyldiamine.
    [250] In the repeated assays, binding of CD11a / IgG4 protein or IgG4 myeloma protein was not detected when any of the immobilized proteins were used. Iα d / IgG4 protein did not bind to fish skin gelatin or bovine serum albumin blocker, human IgG1, or ICAM-1 / IgG. In ICAM-R / IgG protein coated wells using Iα d / IgG4 protein at concentrations of 1-5 μg / ml, binding signals were detected to be increased 2-3 fold over background. Signals in VCAM-1 / IgG protein coated wells were 7-10 times higher than background. In the above assay, α d / CD18 transfected CHO cells did not bind the VCAM-1 / IgG protein, suggesting that VCAM-1 binding may characterize the isolated I domain amino acid sequence.
    [251] Additional α dⅠ Domain Components
    [252] α d Ⅰ, except that much more sikyeotdaneun incorporation of amino acids around the domain, it was prepared in the same manner as in the above-described additional α d Ⅰ domain components of the composition. Specific constructs include the following. Iii) a sequence derived from exon 5 located before the present construct (amino acids 127-353 of SEQ ID NO: 2), ii) an EF-hand repeat next to the first domain (17-603 of SEQ ID NO: 2); Amino acid number 3), and v) alpha chains truncated in the dural region (amino acids 17 to 1029 of SEQ ID NO: 2), which retain the IgG4 tail for purification and detection purposes. The construct is ligated to either mammalian expression vector pDCS1 or prokaryotic expression vector pGEX-4T-3 (Pharmacia), and domain I is sequenced. The fusion protein is then expressed in COS, CHO or E. coli cells transformed or transfected with the appropriate expression construct. Proteins were purified on ProSep A® column (Bioprocessing Limited, Dunham, UK), tested for reactivity with anti-IgG4 monoclonal antibody HP6023 and visualized on polyacrylamide gels with Coomassie staining.
    [253] To construct an expression plasmid for the entire α d polypeptide, pATM.D12 (as described above), the following method is modified to express the α d -IgG4 fusion protein. IgG4 encoding DNA is isolated from vector pDCS1 by PCR using primers incorporated at 5 'AatII restriction sites (SEQ ID NO: 89) and 3'XbaI restriction sites (SEQ ID NO: 90), respectively.
    [254] 5'-CGCTGTGACGTCAGAGTTGAGTCCAAATATGG-3 '(SEQ ID NO 89)
    [255] 5'-GGTGACACTATAGAATAGGGC-3 '(SEQ ID NO: 90)
    [256] Plasmid pATM.D12 is digested with AatII and XbaI and the appropriately digested and purified IgG4 PCR product is ligated into a linear vector.
    [257] Example 15
    [258] Human α dGeneration of Specific-Specific Monoclonal Antibodies
    [259] 1. Transient transfected cells generated from Example 7 were washed three times with Dulbecco's phosphate buffered saline (D-PBS), which was 5 × 10 6 with 50 μg / mouse muramyl dipeptidase (Sigma) in PBS. Balb / c mice were injected at a concentration of cells / mouse. These mice were injected two or more times in the same manner at two week intervals. Pre-bleeded and immunized sera obtained from mice were screened by the FACS assay outlined in Example 9, and the spleens derived from mice were fused, showing the highest reactivity to cells transfected with α d / CD18. Hybridoma culture supernatants were then screened for reactivity defects on COS cells individually transfected with CD11a / CD18 and for reactivity with α d expression plasmid and cells cotransfected with CD18.
    [260] No monoclonal antibodies were produced in this method.
    [261] 2. As an alternative to the production of monoclonal antibodies, soluble α d I domain / IgG4 fusion proteins were affinity purified from the supernatants of stably transfected CHO cells, as described above, to immunize Balb / c mice. Used for. Hybridomas were constructed and the supernatants obtained from these hybridomas were screened by ELISA for reactivity to α d I domain fusion proteins. Positive cultures were then analyzed for reactivity with the full-length α d / CD18 complex expressed in CHO transfectants.
    [262] Mouse 1908 was immunized three times with α d / CD18 transfected CHO cells and then further immunized twice with α d / CD18 heterodimer. Two immunizations included 50 μg / mouse of α d I domain / IgG4 fusion protein. The fusion protein forms 270 IgG-producing wells. The ELISA revealed that the supernatant obtained from 45 wells bound to the Iα d / IgG4 fusion protein at least 7 times higher than human IgG4. FACS analysis revealed that no supernatant reacted with α d / CD18 transfected CHO cells.
    [263] In other cases, to determine whether the supernatant could recognize the integrin alpha subunit protein, freshly frozen spleen specimens were stained with supernatants from 24 wells of 45 wells. Three supernatants were determined to be positive; One stained giant cells in red medulla, while the other two stained scattered cells in red medulla and transverse.
    [264] This supernatant was further analyzed by the ability to immunoprecipitate the biotinylated CD18 complex obtained from α d / CD18 transfected CHO cells or PMA-stimulated HL60 cells. Fusion wells containing supernatants recognizing proteins in the wash lysate (which should not be structurally limited as proteins expressed as heterodimers) were selected for further subcloning. Monoclonal antibodies that recognize proteins in the wash may be more useful for immunoprecipitation of heterodimeric complexes derived from transfectants, tissues and cell lines.
    [265] 3. As another alternative to monoclonal antibody production, the CD18 complex obtained from the human spleen lysate was CD11a / CD18 (using monoclonal antibody TS2 / 4) and CD11b / CD18 (using monoclonal antibody Mo-1). Following preclearance, the cells were immunoprecipitated with anti-CD18 monoclonal antibody 23F2G. Five Balb / c mice, 10-12 weeks old, were immunized subcutaneously with about 30 μg of protein produced in complete Freund's adjuvant on day 0, followed by incomplete per mouse on days 28 and 43 Twice further stimulation with 30 μg immunogen in Freund's adjuvant. Test serum was collected 10 days after the last additional stimulus and diluted at a 1: 500 dilution per serum to assess reactivity and 1 μg of immunogen per lane was detected in Western blot. In fluorescers from three mice, bands of about 95 and 150 kD were detected; No signal was observed in lanes treated with pre-immune serum diluted at a 1:50 dilution. The 150 kD band was assumed to represent α d , a glycosylation state in vivo. In addition, most immune sera were immunoprecipitated with proteins derived from lysates of biotinylated α d / CD18 CHO cells, which migrated to appropriate molecular weight positions on SDS-PAGE representing heterodimers. From these results, on day 64, mouse # 2212 was selected and further immunized by intraperitoneal injection with 30 μg immunogen in PBS. This mouse was killed after 4 days and the spleen was removed aseptically.
    [266] Frozen two glass microscope slides immersed in serum-free RPMI 1640 supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units / ml penicillin and 100 μg / ml streptomycin (RPMI) (Gibco, Canada) Single cell suspensions were prepared by grinding the spleen between the distal ends. The cell suspension was filtered through a sterile 70 mesh Nitex cell strainer (Becton Dickinson, Paciferny, NJ), and the filtrate was washed twice by centrifugation at 200 × g for 5 minutes. The resulting pellet was resuspended in 20 ml serum free RPMI. Thymic cells taken from three native Balb / c mice were prepared in a similar manner.
    [267] Prior to fusion, NS-1 myeloma cells maintained in logarithmic state for 3 days in RPMI containing 10% fetal clone serum (FCS) (Hyclone Laboratories, Inc., Logan, Utah) were 5 × 5 × 5 Pelletized by centrifugation for minutes, followed by two washes as described in the paragraph above followed by counting. About 2 × 10 8 splenocytes were combined with 4 × 10 7 NS-1 cells and the resulting mixture was pelleted by centrifugation at 200 × g. The supernatant was then decanted. Cell pellets were removed by tapping the tube and 2 ml of 50% PEG 1500 in 75 mM Hepes (pH8.0, 37 ° C.) (Boehringer Mannheim) was added over 1 minute with stirring. Then, further 7 ml of serum-free RPMI was added over 7 minutes, followed by 16 ml of RPMI. The resulting mixture was centrifuged at 200 × g for 10 minutes and then the supernatant was decanted. Pellets were 15% FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units / ml Boehringer Mannheim and 1.5 × 10 6 bone marrow cells / Resuspend in 200 ml of RPMI containing ml and distribute it at 200 μg / well to 10 96-well flat bottom tissue culture plates (Coning, UK). On day 2, 4 and 6, after fusion of the cells, aspirate about 100 μl from each well using an 18G needle (Becton Dickinson) and add it to the 100 μl / well plate medium described above, except for 10 units. No addition to wells containing / ml of IL-6 and no thymic cells.
    [268] On days 7-10 after fusion, supernatants from each well were screened by antibody capture ELISA testing for the presence of mouse IgG. 50 μl / well goat antimouse IgA, IgG or IgM (Organon Teknika) diluted in emulon® 4 plate (Dynatech, Cambridge, Mass.) At 1: 5000 in 1:50 in 50 mM carbonate buffer at pH9.6. ). Plates were washed three times with PBS containing 0.5% Tween® 20 (PBST), to which 50 μl of culture supernatant from each well was added. After incubation for 30 minutes at 37 ° C., the wells were washed with PBST as described above, and each well was a horseradish peroxidase conjugated goat antimouse IgG (fc) [Pennsylvania diluted 1: 3500 in PBST]. 50 [mu] l of Jackson ImmunoResearch, West Grove. As described above, the plate was incubated and washed four times with PBST and the substrate consisting of 0.1 μl / ml 30% H 2 O 2 in 100 mM citrate and 1 mg / ml o-phenylene diamine (Sigma). 100 μl (pH 4.5) was added. After 5 minutes, the color reaction was stopped using 50 µl of 15% H 2 SO 4 . The absorbance at 490 nm was determined for each well using a plate reader (Dynatech).
    [269] Hybridomas were further characterized as follows. Α d / CD18-transformed CHO cells that are not reactive to JY cells (B cell lines that are positive for LFA-1 but not positive for other β 2 integrins, as already observed in laboratory staining experiments). Supernatants from IgG-producing cultures were analyzed by flow cytometry for their reactivity. Briefly, 5 × 10 5 of α d / CD18- transfected CHO cells, or the α d / CD18 - was suspended in 50 RPMI containing ㎕ JY cells, a 2% FBS and 10 mM NaN 3 (FACS buffer). Each cell suspension was added to 50 μl of IgG positive hybridoma culture supernatant present in the wells of a 96 well round bottom plate (Coning). After 30 minutes of incubation on ice, the cells were washed twice by pelleting during clinical centrifugation, the supernatant was decanted in each well, and the pellet was resuspended in 200-300 μl of FACS buffer. The final wash was a 50 μl / well 1: 100 dilution of F (ab) ′ 2 fragment of both anti-mouse IgG (H + L) -FITC conjugates prepared in FACS buffer (Sigma, St. Louis, MO) Replaced. After incubation as described above, cells were washed twice with Dulbecco's PBS (D-PBS) supplemented with 10 mM NaN 3 and finally resuspended in D-PBS containing 1% paraformaldehyde. . Samples were then transferred to a polystyrene tube for flow cytometry (FACS) using a Becton Dickinson FACscan analyzer.
    [270] As a result of fusion, four cultures were determined to be positive according to two criteria. After approximately 4 days, the secondary screening method was repeated on the diluted supernatant, in which three of the four cultures remained positive. Three wells (named 169A, 169B, and 169D, respectively) were cloned two to three consecutively, with 2 in RPMI, 15% FBS, 100 mM sodium hypoxanthine, 16 mM thymidine, and 10 units / ml IL-6. Dilute to fold. Well after 4 days the wells of the clone plate were scored visually and the number of colonies in the lowest density wells was recorded. After 7-10 days, selected wells of each cloning were analyzed by FACS. Activity was observed in two of these cultures, 169A and 169B. In final cloning, positive wells containing a single colony were diluted in RPMI using 11% FBS. Antibodies obtained from the clone supernatants of 169A and 169B were sampled using an isotrip kit (Boehringer Mannheim) according to the manufacturer's instructions, and found to be isotypes of IgG1.
    [271] A third screen was performed for specificity using immunoprecipitation of α d / CD18 complex obtained from CHO transfectants and PMA stimulated HL60 cells. Hybridomas 169A and 169B precipitated the appropriate bands obtained from CHO cell lines, single α chain species from 150-160 kD and HL60 determined by SDS-PAGE. Hybridomas 169A and 169B were deposited on May 31, 1995, under the accession numbers HB11907 and HB11906 at the American Type Culture Collection, 20852, Rockville, Parkron Drive 12301, Maryland, USA.
    [272] To characterize the binding properties of 169A and 169B in more detail, each antibody was tested for its ability to inhibit the binding of other or anti-CD18 antibody TS1 / 18.1 to soluble α d / CD18. Soluble full length α d / CD18 was immobilized with each unlabeled antibody in a 96 well plate format and biotinylated antibodies were used to detect proteins bound by the same or different unlabeled antibodies. After binding was detected using goat antimouse Ig / HRP conjugates, OPD substrate was added. As a result, it was found that antibody 169A blocked the binding of biotinylated 169A and TS1 / 18.1, while antibody 169B blocked the binding of itself.
    [273] 4. Another immunized mouse (# 2214) was screened by the same protocol as for mouse # 2212 and preliminary fusion immunization with 30 μg purified α d obtained from spleen lysate in PBS on day 70 Further immunization was performed. After 4 days the mice were killed and the spleen was aseptically isolated.
    [274] Fusion and cloning of positive cells was performed as described above. The fusion resulted in five anti α d monoclonal hybridomas named 170D, 170F, 170E, 170X and 170H, respectively, sampled as IgG 1 using the IsoStrip kit (Boehringer Mannheim) according to the manufacturer's instructions. .
    [275] 5. Select # 2211, another mouse immunized by the same initial protocol as mouse # 2212 and mouse # 2214, using 30 μg immunogen on day 88 and 30 μg on day 203 Further immunization was performed using preliminary fusion supplemental immunization. After 4 days the mice were killed and the spleen was removed, followed by fusion as described above. As described in the paragraph above, hybridoma supernatants were screened by ELISA for antibody capture and flow cytometry.
    [276] Fifteen hybridomas were identified and they were named 188A, 188B, 188C, 188E, 188F, 188G, 188I, 188J, 188K, 188L, 188M, 188N, 188P, 188R, and 188T, respectively, and sampled in the ELISA assay. In brief, 50 μl / well goat anti-mouse IgA, G, diluted with emulon® 4 plates (Dynatech, Cambridge, Mass.) At 1: 5000 diluted 1: 5000 in 50 mM carbonate buffer (pH9.6) at 4 ° C. Coated with M (Organon Teknika). Plates were blocked with 1% BSA in PBS for 30 minutes at 37 ° C., washed three times with PBS / 0.05% Tween® 20 (PBST), followed by 50 μl culture supernatant (1:10 dilution in PBST). Added. After incubation and washing as described above, 50 μl of horseradish peroxidase conjugated rabbit anti-mouse IgG 1 , G 2a or G diluted 1: 1000 in PBST containing 1% normal goat serum 50 μl of 3 (Zymed, San Francisco, CA) was added. As described above, the plates were incubated and washed four times with PBST, then 1 mg / ml o-phenylene diamine (Sigma) and 0.1 μl / ml of 30% H 2 O 2 in 100 mM citrate. 100 μl of substrate (pH 4.5) was added. After 5 minutes, 50 µl of 15% H 2 SO 4 was added to stop the color reaction. Reading the A 490 value on a plate reader (Dynatech) determined that all 15 antibodies were IgG1.
    [277] Excess splenocytes obtained from mouse # 2211 were frozen in freezing vials and stored in liquid nitrogen. The frozen vial was placed in a 37 ° C. water bath and thawed rapidly, and the annular motion was operated only until the contents melted. Cells were transferred to a 15 ml centrifuge tube where warm RPMI containing 11% FBS was slowly added 1 ml at a time, with a time interval of 3 to 5 minutes. After adding 5 ml of warm RPMI and waiting for 5 minutes, the tube was centrifuged at 200 × g for 5 minutes and the supernatant was aspirated. Cells were resuspended in RPMI and fusion was performed as described above. Hybridoma supernatants were screened by antibody capture and flow cytometry as described above.
    [278] Fusion resulted in 5 clones, which were named 195A, 195C, 195D, 195E and 195H, respectively. Clones were sampled by the ELISA method as described above; Monoclonal antibodies 195A, 195C, 195D and 195E were determined to be IgG 1 and 195H was IgG 2a .
    [279] 6. In another attempt to generate antiα d monoclonal antibodies, mice # 2213 were immunized using the same protocol as mice 2214, 2211 and 2212, but at Sep 414 and 441 days Sepharose® ) Further immunization with 30 μg human α d / CD18 leucine zipper (LZ) bound on beads. Immunogens for mouse # 2213 were prepared by immunoprecipitating human α d / CD18 LZ (Example 14) with anti-CD18 monoclonal antibody and Protein A Sepharose®. The precipitated complex was resuspended in the form of a slurry in 1: 1 ratio with PBS before injection. The mice were killed on day 4 after further immunization. As mentioned above, the spleen was removed and fusion was performed.
    [280] Positive hybridomas were identified by ELISA using human α d / CD18 LZ immunized with F (ab) ′ 2 fragment of unblocked antiCD18 antibody. Briefly, the F (ab) ′ 2 fragment was coated at a concentration of 100 ng / well on an Emul® 4 ELISA plate overnight at 4 ° C. After aspirating off the buffer, the wells were blocked with 0.5% fish skin gelatin (Sigma) at 37 ° C. for 30 minutes. After washing three times in PBST, 50 μl / well of supernatant obtained from CHO cells previously transformed with plasmid encoding soluble α d / CD18 LZ was added and the plate was incubated at 37 ° C. for 30 minutes. The washing step was repeated and 50 μl / well of hybridoma supernatant was added. Detection of monoclonal antibodies was performed as described above. Positive wells were analyzed by flow cytometry using CHO cells transformed with DNA encoding α d / CD18, in which two positive hybridomas (named 212A and 212D, respectively) were identified. Antibodies secreted by hybridomas were sampled as IgG1 using the homologous ELISA method as described above.
    [281] 7. In another method for generating antihuman α d monoclonal antibodies, mice were immunized with α d / CD18LZ Sepharose® beads prepared as described above, on days 0, 36 and 66 On the day, each mouse received 30 μg of immunogen. As described above, after screening mouse serum in recombinant protein ELISA format, mouse # 2477 was selected for fusion. Fusion, selection and cloning methods were performed in the same manner as described above for fusion 212. Seven hybridomas were identified, 217F, 217G, 217H, 217I, 217K, 217L and 217M, which lost the reactivity measured by flow cytometry during the last round of cloning. Antibodies from the remaining six hybridoma cell lines were sampled as described above, all of which were found to be IgG1.
    [282] 8. In another method for generating α d monoclonal antibodies, immunize mouse # 2480 by the same protocol as for mouse # 2477, but at 30 μg α d / CD18LZ on days 217 and 218. Further inoculation by intraperitoneal injection. Mice were killed on day 221 and spleens were removed as described above followed by fusion. Hybridoma supernatants were screened by ELISA as described above, and reactivity against JY cells already transfected with DNA encoding α d / CD18LZ was determined by flow cytometry. As described above, the screening method was performed. Fusion resulted in three positive hybridomas, 240F, 240G and 240H, which secreted the antibodies sampled by ELISA to all IgG1. The fourth hybridoma 240I was then characterized as an IgG1 isoform.
    [283] 9. To identify antibodies capable of inhibiting functional α d binding, soluble α d / CD18LZ (see Example 14) was used for immunization. Protein was isolated from the supernatant of transiently transfected COS cells on an affinity chromatography resin, and this resin bound α d was used as the immunogen. Selected mice were immunized as described above to finally further immunize 2 weeks after the initial immunization. Immunization with this technique often inhibits changes that may occur on the protein morphology associated with washing lysates of cells. Additional mice were also immunized with recombinant protein bound to resin, but not initially with purified protein from cell lysate.
    [284] Immunization-produced hybridomas, prepared as described above, were screened by ELISA for immobilized recombinant proteins derived from cell supernatants using Fab fragments of nonblocking antibodies. In contrast, flow cytometry was used to fractionate reactivity to JY cells already transfected with α d cDNA.
    [285] 10. As another alternative, monoclonal antibodies were generated as follows. Affinity purified α d / CD18 heterodimeric protein obtained from washing lysates of stably transfected CHO cells was used with 50 μg / ml of muramyl dipeptidase to immunize Balb / c mice as described above. Mice were immunized three times prior to immunoprecipitation of the biotinylated complex in the CHO transfectants to determine serum reactivity to α d / CD18. Hybridoma cultures were selected by flow cytometry using α d / CD18 transfectants after constructing the hybridomas obtained from positive animals according to standard protocols. CD11a / CD18 transfectants were used to modulate only CD18 reactivity.
    [286] 11. As another alternative for monoclonal antibody production, an immunization / immunosuppression protocol was performed with Balb / c mice designed to reduce reactivity to CHO cell determinants on the transfectants used for immunization. This protocol involves immunization with untransfected CHO cells followed by treatment of cyclophosphamide to kill CHO reactive B cell blasts. After three immunizations, cyclophosphamide treatment was performed, wherein the mice were immunized with α d / CD18 CHO transfected cells as described above.
    [287] 12. As another alternative, the CD18 complex obtained from washing lysates of PMA stimulated HL60 cells was amplified with preclearance as described above. Other β2 integrins were removed on the same column. Immunization, hybridoma production and screening methods using the resulting complexes were performed as described above.
    [288] Production of Polyclonal Serum
    [289] Polyclonal anti-serum was generated in rabbits using purified α d I domain / IgG4 chimera (Example 14). Initially, the α d I domain / IgG4 antigen in complete Freund's adjuvant was injected in an amount of 100 μg per rabbit, followed by three additional inoculations with the same amount of protein in incomplete Freund's adjuvant. Test blood was analyzed after the third and fourth injections. Rabbit immunoglobulin (Ig) was purified from serum on Protein A-Sepharose® column and pre-cleared anti-human IgG reactivity on human IgG / Affigel® 10 column. Complete preclearance was confirmed using ELISA reactivity against non-human IgG I domain chimeras.
    [290] Proteins were immunoprecipitated from lysates of surface-biotinylated CHO cells previously transfected with α d vectors and CD18 expression vectors using precleared polyclonal serum. Immunoprecipitation was performed by the method described in Example 10. Precleared serum recognized protein complexes with the same molecular weight as precipitated by the anti-CD18 monoclonal antibody TS1.18. In addition, serum recognized a single band of appropriate size via Western blot of the CD18 complex in CHO cells transfected with α d / CD. Affinity purified integrin CD11a / CD18, CD11b / CD18, and VLA4 from human spleens were not recognized by rabbit polyclonal serum. When measured by flow cytometry, this serum did not react with CHO cells transfected with α d in solution. Therefore, it can be concluded that polyclonal rabbit serum can only recognize denatured α d I domain / IgG4 protein.
    [291] To generate polyclonal antiserum against α d / CD18, mice were inoculated three times with α d transfected CHO cells (D6.CHO, α d / CD18) with an adjuvant peptide and purified α d / CD18. Heterodimer was inoculated once. The final antigen contained only α d / CD 18 heterodimer. Serum inoculated with about 100 μl was precleared by adding about 10 8 LFA-1 transfected CHO cells at 4 ° C. for 2 hours. The α d reactivity of the resulting serum was analyzed at dilution rates of 1/5000, 1/10000, 1/20000, and 1/40000 on normal human spleen. Polyclonal sera showed reactivity at a dilution of 1/20000 but stained very weakly at a dilution of 1/40000.
    [292] Example 16
    [293] Anti-α dFlow cytometry analysis using monoclonal antibodies
    [294] Seven primary and immobilized cell lines were used for anti-α d monoclonal antibody 212D, 217K and 217L measurements. Cell staining was performed following the method described in Example 17 and analyzed. MAGE-3 (melanoma associated proteins) specific primary CD8 + / CD56 on - and CD4 - / CD8 - / CD56 + cell lines Despite appear strongly positive for CD11b and CD11c, were not stained by any α d antibody. Peptide containing antigen presenting cells (APCs, dendritic cells or monocytes) were used to amplify MAGE-3-peptide-specific cells from the peripheral blood mononuclear cell population. Repeated stimulation with phenotypic selection under limiting dilution conditions results in clonal cell dissolution, which specifically kills target cells containing natural proteins derived from peptides.
    [295] Dendritic cells from peripheral blood cultured for 7 days in the presence of cytokine IL-4 and GM-CSF were strongly stained with antibodies to CD11a, CD11b and CD11c and 217L anti-α d antibodies. The 212D, 217K, 217I, 217H, and 217M antibodies not only reacted with these cells in repeated experiments, but also with dendritic cells with various donors. By incubation for 14 days, the surface expression of 217L antigen was reduced and staining disappeared completely by day 21. During the incubation period, CD11b and CD11c expression was present at high concentrations (2-3 log function for background staining).
    [296] Example 17
    [297] Α of human monocytes from peripheral blood dExpression of human monocytes through purification
    [298] About 300 ml of blood was taken from volunteer donors and placed in 3.8% sodium citrate buffer (Sigma). This blood was diluted with PBS (Sigma) free of endotoxin to 480 ml, and 30 ml of diluted blood was carefully stacked on 17 ml hidopaque in a 50 ml centrifuge tube. The gradient was spun for 30 minutes at a speed of 1500 rpm in a Beckman Tabletop Centrufuge. Cell layers representing monocytes were harvested from each gradient and transferred to a new 50 ml tube. PBS of endotoxin glass, 0.1% BSA (endotoxin glass) was added to a volume of 50 ml, and the tube was centrifuged for 15 minutes at a speed of 1500 rpm in Beckman Tabletop Centrufuge. The supernatant was decanted and the cells resuspended in small amounts of PBS / BSA and then colonized.
    [299] A second gradient, which uses Percoll [Denholm & Wolber, J. Immunol. Meth. 144: 247-251 (1991)], was required to purify monocytes from the mixed population of cells obtained as described above. In short, 10 ml of 10 × Hanks Buffer (Gibco) was mixed with 600 μl of 1.0 N HCl, to which 60 ml of Percoll (Pharmacia, Piscataway NJ) was added and the mixture was slowly stirred to bring all Percoll into solution. After adjusting the pH of the Percoll solution to 7.0, 8.0 ml of gradient mixture was added to six 15 ml round bottom polystyrene tubes, exactly 4.0 ml of the cell suspension was added to each gradient and the tube was taken 7 times. The gradient was centrifuged at room temperature at 1690 rpm in a fixed angle rotator for 25 minutes at room temperature The monocyte fraction, which appeared as a thin white band in the gradient, was collected and transferred to a new 50 ml centrifuge tube. The volume was adjusted to 50 ml using BSA and the cells were pelleted by centrifugation Cell pellets were resuspended in small amounts and grouped and measured using a hematology counter.The cells were measured using FACS buffer (RPI 1640, 2.0% Resuspended in FBS, 0.2% sodium azide) and adjusted to 1 million cells for one condition, ie 1 million cells were used in each FACS staining condition to analyze various cellular markers.
    [300] FACS staining and analysis
    [301] Single antibody cell staining was performed using an antibody specific for a d or cell marker conjugated directly with a fluorescent tag detectable marker. After adding mouse anti-human α d antibody 212D or 217L to the cells at 10 μg / ml, the mixture was incubated on ice for 30 minutes and washed three times. 10 μl of the directly conjugated cell marker, CD3-FITC (Becton-Dickinson) (specific to T cells) or CD33-FITC (Becton-Dickinson) (specific to monocytes) was added to additional cell samples, 10 Μl of the second antibody, anti-mouse FITC (Sigma), was added to 212D and 217L stained cells. All samples were incubated for 30 min in the dark on ice, washed three times and resuspended in 300 μl of 2.0% paraformaldehyde. Samples were processed on Becton Dickinson FACScan and data were analyzed using Lysys II software (Becton Dickinson).
    [302] In the first experiment, monocytes represented 68% and T-cells 18% of the total cells purified using the dual gradient method. Staining two cell type cells for α d with 212D and 217L took significant amounts, ie 55% for 212D and 65% for 217L. Based on later experiments, although isolated monocytes were always stained positive, there was some variation of donor versus donor in the relative amounts of α d staining in newly isolated human monocytes. When human IgG (used at 1 mg / ml for 10 minutes on ice before addition of the primary antibody) was added to the cells to resolve any possible Fc receptor binding problem, there was no change in α d staining. These cells were cultured in suspension using a Hydron coated dish (Interferon Sciences) in 10% FBS / RPM-1640, and when analyzed for α d expression, there was a loss of surface expression within 24 hours and 7 days. It continued to decrease until the time course of. Α d staining was low with respect to the expression of other integrins in newly isolated human monocytes, including CD11a, CD11b and CD11c.
    [303] 2. α d-Color FACS staining of human monocytes
    [304] For two-color FACS staining, 212D and 217L antibodies were biotinylated using NHS-LC-Biotin (Pierce) according to the manufacturer's instructions. In a separate experiment, cells were isolated as described above and stained with biotinylated 212D and 217L antibodies and biotinylated control IgG1 antibodies using 10 μg / ml on ice for 30 minutes. Cells were washed three times in FACS buffer (modified to include D-PBS, 2% FBS, and 0.2% sodium azide) and then resuspended in 1.0 ml FACS buffer. 10 μl of FITC conjugated CD33 (monocyte specific) and 5 μl of streptavidin PE (PharMingen) were added to the cell suspension. Samples were incubated for 30 min in the dark on ice and washed three times in FACS buffer. It was then resuspended in 300 μl of 1% paraformaldehyde. Samples were processed by FACS as described above.
    [305] Of the two antibodies, 217L was significantly better stained on CD33 + compared to the control. Antibody 212D also stained this cell type, but the number of CD33 + cell staining was significantly less than that observed with antibody 217L. This result is consistent in two separate experiments. In related experiments with biotinylated antibodies 212D and 217L, 217L-biotin consistently showed more cell staining than 212D-biotin.
    [306] Mononuclear cells showing a mixture of lymphocytes and monocytes obtained prior to Percoll gradient isolation were detected by the two-color assay described above, 212D and 217L-biotin in double staining in combination with FITC-conjugated antibodies were identified as CD3 (T cells), CD4 (helper T cells), CD5 (thymocytes, mature T cells, subpopulations of B cells), CD8 (cytotoxic / suppressor T cells), CD14 (monocytes, neutrophils, vesicular dendritic reticulum cells), CD20 (B Cells), and CD56 (NK cells, a subset of T cells) (Becton Dickinson). The α d positive population of cells co-expressed with these cellular markers was not seen.
    [307] Example 18
    [308] α dAnalysis of the distribution
    [309] Tissue distribution of α d / CD 18 was measured using polyclonal antiserum prepared as described in Example 15.
    [310] Purified rabbit polyclonal antibodies were used at a concentration of 120 ng / ml to 60 μg / ml for immunohistochemical analysis of frozen human spleen sections. Sections of 6 micron thickness were laminated on Superfrost Plus slides (VWR) and stored at -70 ° C. Before use, the slides were taken out at -70 ° C and placed at 55 ° C for 5 minutes. The sections were then fixed for 2 minutes in cold acetone and air dried. This section was blocked for 30 minutes at room temperature in a solution containing 1% BSA, 30% normal human serum and 5% normal rabbit serum. Primary antibody was added to each section at room temperature for 1 hour. Slades were washed three times in TBS buffer (5 min once) to remove unbound antibody. Rabbit anti-mouse IgG binding antibodies were then added to each section in the same TBS buffer. Mouse alkaline phosphatase anti-alkaline phosphatase (APAAP) antibodies incubated at room temperature for 30 minutes were used to detect secondary antibodies. The slides were then washed three times in TBS buffer. Fast Blue substrate (Vector Labs) was added and the color reaction was stopped by immersion in water. Slides were counterstained in Nuclear Fast Red (Sigma), rinsed in water and mounted on Aqua Mount (Bacter). Staining was detected by the above reagents in splenomegaly and not using unrelated rabbit polyclonal Ig preparations or crude pre-immune serum from the same animal.
    [311] Once mouse serum was determined to have specific α d reactivity, it was used to stain various lymphoma and nonlymphoma tissues. Monoclonal antibodies recognizing CD18, CD11a, CD11b, and CD11c were used in the same experiment as a control. The results of staining normal spleen sections using α d polyclonal serum and monoclonal antibodies against CD11a, CD11b, CD11c, and CD18 were as follows. The pattern observed using the α d polyclonal serum did not show the same label pattern as CD11a, CD11b, CD11c, or CD18. There is a unique labeling pattern in some of the cells located at the edges of the whites and a unique labeling pattern in the cells around the edges. This pattern was not observed when other antibodies were used. Individual cells scattered throughout the adipocytes, which may or may not be the same population or subpopulation observed using CD11a and CD18, were also labeled.
    [312] Labeling with CD11c showed some cell staining in the marginal zone, but the antibody did not show a distinct ring pattern around the white ratio compared to the α d polyclonal serum and the labeling in the antagonist α d polyclonal serum It did not show the same staining pattern as.
    [313] Thus, the labeling pattern observed using the α d polyclonal serum was unique compared to that observed with antibodies to other β 2 integrins (CD11a, CD11b, CD11c and CD18), which is different from that of human d in humans. It suggests that the distribution in vivo is different from that of other β 2 integrins.
    [314] Human α using monoclonal antibody dCharacterization of expression
    [315] Antibodies secreted by hybridomas 169A and 169B were used to analyze the expression of human α d on tissue sections frozen by immunohistochemistry and on cell lines and peripheral blood leukocytes by flow cytometry. Hybridoma supernatants were not diluted in both sets of experiments.
    [316] Tissue staining
    [317] All staining was performed as described above, except that liver sections were stained as follows. After acetone fixation, sections were quenched for 15 minutes at room temperature in 1% H 2 O 2 and 1% sodium azide in TBS. After primary antibody staining, rabbit anti-mouse antibodies conjugated directly to peroxidase were added at room temperature for 30 minutes. Slides were washed three times with TBS buffer. Porcine anti-rabbit antibodies conjugated directly to peroxidase were incubated for 30 minutes at room temperature to detect secondary antibodies. Slides were then washed three times in TBS buffer and AEC substrate (Vector Labs) was added to develop the color reaction. The slides were counterstained with hematoxylin road 2 (Sigma), rinsed in water and then dehydrated and mounted.
    [318] In spleen sections, most of the expression was concentrated in the splenic erythrocytes on cells identified by granulocytes and macrophages by morphology. The majority of granulocytes were stained, but only a subset of macrophages showed signals. A few follicular dendritic cells in the white ratio were weakly stained with the α d antibody. CD11a and CD18 staining were detected throughout the red and white ratios. CD11c staining was more pronounced in the spleen and the macrophages, which are believed to be macrophages in the marginal zone around the baekshui, with diffuse staining at the antagonists. CD11b was found not to be identical to α d in the red ratio but with an overlapping distribution and was not related to the white ratio.
    [319] Integrin expression in normal and (rheumatic) arthritis synovial tissue was compared. Minimal staining with all anti-integrin antibodies (including CD11a, CD11b, CD11c, CD18 and α d and specific immunoreactive antibodies) was observed in normal tissues and showed wide distribution in endogenous cells, especially macrophages. . In inflamed synovial fluid, all integrin expression was more concentrated in cells that gathered around the lymphatic vessels. The α d and CD11b expression patterns were similar, but CD11c did not appear to be strongly expressed and was localized to a subset of leukocytes.
    [320] In dogs, CD11b expression but not α d was observed in hepatic macrophages, ie Cooper cells. Staining of normal human liver sections (as described above for staining of dog liver sections) confirmed that this staining pattern was preserved in humans as well. In addition, CD11c was detected at low levels. In sections from hepatitis patients, all leucointegrin staining was more than observed in normal liver, whereas α d expression was detected in macrophages and granulocytes of these samples.
    [321] Minimal staining of normal human colon sections was observed using anti-α d antibodies. Light smooth muscle staining and leukocyte staining were observed. Sections from Crohn's disease patients detected high levels of all leucointegrins.
    [322] Normal lungs showed a limited number of weak anti-α d positive cells. They were determined to be macrophages and neutrophils. In lung tissues from emphysema patients, α d staining was observed in macrophages containing neutrophils and hemosiderin (iron-containing pigments), indicating that red blood cells were infiltrated into these cells.
    [323] Sections of plaque lesions from normal brain and multiple sclerosis (MS) patients were observed for integrin expression. In normal brain, α d staining was less intense than that of CD11a, CD11b and CD1c, and was restricted to cells characterized by microglia according to morphology and CD86 staining. CD11b positive cells were located around the blood vessels and throughout the tissue. CD11c + cells were found to be located in the vessels, whereas α d + cells were found to be located around the vessels. In MS tissue sections, α d expression was observed in both microglia and non-phagocytic leukocyte subpopulations, and α d + cells were present in plaque lesions and throughout the cortex. The α d signal was comparable in intensity to CD11c but less than that of CD11b.
    [324] Both thoracic and abdominal aortic sections from PDAY (pathological determinants of atherosclerosis in adolescents, LSU Medical Center) tissue samples were analyzed using anti-leucointegrin and anti-CAM antibodies. The lesions observed were consistent with aortic fat glands, consisting of subendovascular aggregates of giant foam cells (most macrophages contain lipids) and infiltrating smaller white blood cells. Single labeling experiments using monoclonal antibodies specific for α d and other β 2 integrin α chains (CD11a, CD11b, and CD11c) and macrophage markers (CD86) showed that most of the fat-containing macrophages were moderately α d And CD18, while CD11a and CD11c have been shown to express weakly or moderately to moderately, respectively. CD11b was weakly expressed and expressed only in some of the macrophages.
    [325] Double labeling experiments were performed to determine the relative positions of α d and ICAM-R antigens in the aortic sections. The foam cells were not derived from endovascular smooth muscle cells because the foam cells in these sections were stained with antibody Ham 56 specific for macrophage markers, not antibodies to smooth muscle actin. CD86 positive macrophages expressing a d were surrounded and interspersed by small ICAM-R positive leukocytes. A limited number of small white blood cells have been shown to be stained with both CD86 negative or both α d and ICAM-R antibodies.
    [326] The distribution of α d in normal tissues is not identical to that of CD11b and Cd11c, but has been shown to exist on the intrinsic leukocytes in an overlapping pattern, and two other leucointegrin α chains have already been identified as having a limited leukocyte distribution. . The cell morphology showed that α d staining was mainly limited to macrophages and granulocytes, with a limited number of leukocytes stained. In general, tissue inflammation appears to increase the number and type of leukocytes observed in certain tissues, with increased staining of leucointegrins, including α d . Since the intracellular and spatial distribution of leucointegrin is not the same as in pathological tissues, it is estimated that unique functions and ligands exist for members of each family, including α d , depending on the specific configuration.
    [327] An interesting fact is that α d expression in early atherosclerotic lesions appears to be more pronounced than the expression of CD11a, CD11b and CD11c, suggesting that α d plays an important role in the establishment of these lesions. opposite the distribution of α d and a, α d and ICAM-R positive cells, supported by evidence suggesting an interaction between ICAM-R it is that α d may be involved in leukocyte mobilization or activation at early stages in these lesions Hints.
    [328] Cell Lines and Peripheral Blood Leukocyte Staining
    [329] Antibodies 169A and 169B stained HL60, a progenitor means cell line according to FACS. Surface expression of α d in these cells was negatively affected by PMA stimulation, which has been reported to induce differentiation along the macrophage pathway, but not by DMSO inducing granulocyte differentiation [Collins et al., Blood 70 : 1233-1244 (1987). The FACS profiles of 169A and 169B were opposite to those observed using anti-CD11b and CD11c monoclonal antibodies for PMA stimulation. Monocyte cell line THP-1 was also weakly stained according to 169A and 169B. In addition, a subset of cells in lymphocytes and monocyte gates of peripheral blood leukocytes showed a weak positive response by FACS. Some of the peripheral blood monocytes were weakly stained by 169A and 169B, while B lymphocytes were found not to exhibit surface expression of α d . The CD8 + subset of T lymphocytes was α d + . In addition, antibodies 169A and 169B did not detect antigens on B cell lines JY, Ramos, basophil cell line KU812 and T cell lines Jurkat, SKW and Molt 16.
    [330] As a result of using HL60 cells, granulocytes were isolated from peripheral blood by Piccol / Hyfake gradient centrifugation and erythrocytes were lysed. All preparations were observed to have nuclear form in acetic acid and found to be at least 90% PMN. Individual populations were stimulated with 50 ng / ml PMA or 10-8 M formyl peptide (fMLP) for 30 minutes to release potential intracellular integrin reservoirs. The unstimulated population, although low, expressed significant levels of 169A and 169B antigens compared to the IgG1 control, with a detectable increase observed upon stimulation. On PMN, α d and CD11c surface expression were more similar than those observed on HL60 cells. Heterodimer molecules were then precipitated from detergent lysates of biotinylated PMN using antibody 169B, with subunit sizes of about 150 and 95 kD corresponding to α d and CD18, respectively.
    [331] The presence of α d on PMN could not be inferred from known information regarding dog α d expression. Dog neutrophils, unlike human neutrophils, express the T helper cell marker CD4, as well as integrin VLA-4, and thus dogs may possess different ligands and functions than humans.
    [332] Staining of PBL Subgroups
    [333] This experiment was performed to determine the distribution of this β 2 integrin in human peripheral blood leukocytes. In addition, the cell surface densities of α d relative to other β 2 integrins were compared. Finally, acute regulation of α d expression in purified human eosinophils was also evaluated.
    [334] Human peripheral blood leukocytes were separated into mononuclear cell fractions (including monocytes, lymphocytes, and basophils) and granulocytes (neutrophils and eosinophils) by density gradient centrifugation [Warner et al., J. Immunol. Meth. 105: 107-110 (1987). In some experiments, eosinophils were purified to greater than 95% purity using CD16 immunomagnetic separation [Hansel et al., J. Immunol. Meth. 122: 97-103 (1989). Skin mast cells were enzymatically dispersed from human skin and concentrated as described above [Lawrence et al., J. Immunol. 139: 3062-3069 (1987).
    [335] Cells were labeled with appropriate dilutions of monoclonal antibodies specific for CD11a (MHM24), CD11b (H5A4), CD11c (BU-15), or α d (169A). The mouse control IgG 1 was also used. The cells were washed and then incubated with phycoerythrin-conjugated goat-anti-mouse IgG. In some experiments, cells were treated with excess rat IgG and FITC-labeled rat monoclonal antibodies or goat polyclonal antibodies specific for certain cells (eg, CD3, CD4, or CD8 for T cells; CD16 + for NK cells). Lymphocytes; anti-IgE for basophiles) incubated with Bochner et al., J. Immunol. Meth. 125: 265-271 (1989). This sample was then observed by flow cytometry (Coulter EPICS Profile) using appropriate gating to identify a subset of cells.
    [336] For experiments with human eosinophils in which acute upregulation of α d expression was observed, cells were treated with povol esters (10 ng / ml), RNATES (100 ng / ml) [Schall, Cytokine 3: 165-183 (1991)], Or stimulated with IL-5 (10 ng / ml) at 37 ° C. for 15 minutes and labeled using various monoclonal antibodies as described above.
    [337] α d was found to be present in all peripheral blood eosinophils, basophils, neutrophils, monocytes and NK cells. A small subset of CD8 + lymphocytes (about 30%) was also found to express α d . Skin mast cells and CD4 + lymphocytes did not express α d . In general, CD11a and CD11b are present at greater density than α d on leukocytes, and α d is expressed at relatively low levels similar to CD11c. Among leukocytes, monocytes and CD8 + cells have the highest density of α d , whereas eosinophils express the least α d . The expression on neutrophils, basophils and NK cells was moderate.
    [338] Stimulation of peripheral eosinophils with CC chemokine RANTES did not induce changes in the expression of any β 2 integrins. However, treatment with four-bolus esters increased the expression of CD11b and α d 2-3 fold, but did not affect the expression of CD11a or CD11c. IL-5 treatment selectively upregulated CD11b expression and did not affect the expression level of other integrin subunits.
    [339] Taken together, these results show that α d is expressed at a level similar to that of CD11c in peripheral blood leukocytes. It was most expressed in a subset of monocytes and CD8 + lymphocytes. Human skin mast cells do not express α d . Purified eosinophils appear to have preformed intracellular storage pools of CD11b and α d . However, the differential upregulation seen by IL-5 vs. PMA suggests that these storage pools are independent of each other.
    [340] As described above, staining patterns for peripheral blood leukocyte (PBL) subgroups were also determined by flow cytometry using gating and surface markers to define more precisely 169 A / B negative lymphocyte groups. PBLs were isolated on Ficoll as described above, and 169A, 169B and CD114 (monocyte / macrophage markers), CD20 (B cells), CD56 (NK cells), T cell receptor α / β (T cells), CD16 ( Staining was performed using monoclonal antibodies against neutrophils, NK) and α4 (negative markers for neutrophils). Gates were defined by size and marker distribution. The results indicated that cells at the CD14 + monocyte gates had less 169A and 169B staining. The dual expression pattern observed in previous experiments at the lymphocyte gate was resolved by increasing the forward scatter. The mixed TCR + / CD20 + populations were shown to have low but uniform 169A / B expression, whereas the populations mapped at slightly higher lateral scattering (cell complexity) stained 50% positive for CD56 and were unique 169 A / B negative population. Negative populations were also not recognized by TCR, CD20, CD14 or CD16 antibodies.
    [341] α dSynovial distribution
    [342] To determine the intracellular distribution of α d , other β 2 integrins and their corresponding receptors in inflammatory and non-inflammatory synovial fluid, monoclonal antibodies against various β 2 integrins, and immunoglobulin supergene families were used for immunohistochemical analysis. It was. Protein expression was measured in normal, osteoarthritis and rheumatoid synovial tissue samples.
    [343] The results showed that the synovial endothelial cell layer expressed large amounts of VCAM-1, CD11b / CD18 and α d / CD18. In these cells, CD11c / CD18 expression was limited and CD11a / CD18 was largely undetectable. In rheumatoid arthritis synovial fluid, the expression of β 2 integrins in the synovial cell layer increases in proportion to the degree of hyperplasia. The proportion of cells expressing CD11c increased markedly to approximate the expression of CD11b and α d , but CD11a expression did not increase.
    [344] In the subendothelium of tissues, aggregates and diffuse infiltrates of CD3 / CD11a / ICAM-R + lymphocytes are interspersed in CD68 / CD11b / α d + macrophages. Many of the aggregates showed intense α d staining, especially in regions rich in T cells.
    [345] Synovial endothelial cells expressed various expressions of ICAM-1 and ICAM-2, and minimal expression of ICAM-R.
    [346] Taken together, these results show that synovial macrophages and macrophage-like synovial cells express constitutively high levels of β2 integrin CD11b and α d . In synovitis, subpopulations of these cells appeared in both the endocardium and subendothelial regions, with a marked increase in the expression of CD11c. Certain populations of rheumatoid synovial T lymphocytes express large amounts of α d as well as CD11a and ICAM-R, and the α d molecule has been shown to be expressed in small amounts by peripheral blood lymphocytes.
    [347] Α in diseased lung and liver tissue dExpression of
    [348] Lung tissue from sarcoidosis patients and liver tissue from two patients with cirrhosis were incised to a thickness of 6 μm and air dried on a Superfrost Plus (VWR Scientific) slide at room temperature for 15 minutes. The slides were incubated at 50 ° C. for about 5 minutes before use. Sections were fixed for 2 minutes at room temperature in cold (4 ° C.) acetone (EM Science) and then air dried at room temperature. Sections were placed in a solution of 100 ml of 1 × TBS, 1.1 ml of 30% H 2 O 2 (Sigma), 1.0 ml of 10% NaN 3 (Sigma) for 15 minutes at room temperature to remove endogenous peroxidase activity. Each section was blocked for 30 minutes at room temperature in 150 μl of a solution containing 20% normal human serum (Boston Biomedica), 5% normal rat serum (Halan), and 2% BSA (Sigma) in 1 × TBS. After incubation, the solution was removed by gentle blotting from the sections. Primary monoclonal antibodies were prepared at a protein concentration of 10 μg / ml in blocking solution and 75 μl was added to each tissue section for 1 hour at room temperature. After incubation, sections were washed three times in 1 × TBS (5 minutes per wash) to remove unbound antibody. Excess was washed last by aspiration after removing TBS. Biotinylated rat anti-mouse antibody (Jackson Laboratories) was diluted 1: 400 in blocking solution and 75 μl was added to each section for 30 minutes at room temperature. Slides were washed twice with 1 x TBS (5 minutes per wash). Peroxidase conjugated goat anti-biotin antibody (Vector Laboratories) was diluted 1: 200 in blocking solution and 75 μl was added to each section for 30 minutes at room temperature. Slides were washed twice with 1 x TBS (5 minutes per wash). Substrate 3-amino-9-ethylcarbazole (AEC) (Vector Laboratories) or 3,3'-diaminobenzidine (DAB) substrate (Vector Laboratories) was added and immersed in water to give a color reaction. Stopped. Slides were counterstained in Gil Hematoxylin # 2 (Sigma), rinsed in water and then mounted with Aquamount (Bacter) or Cytosyl (VWR).
    [349] In sarcoidosis lungs, only 217L monoclonal antibodies stained the cells and most of the 217L epitope expression was concentrated on granulomas. Giant cells in granulomas have been shown to be negative for 217L antigen. Expression of the 217L epitope was concentrated in cells that appear to be epithelial histocytes, which are morphologically highly differentiated phagocytes of the macrophage lineage. The distribution of other integrins was observed to overlap with that of the 217L epitope in sarcoidosis lung, but the expression patterns were not identical. For example, in granulomas, antibodies specific to all other integrin-labeled cells as well as giant cells were negative for 217L staining.
    [350] Sections from the second patient diagnosed with sarcoidoma were negative for the expression of the 217L epitope, but it was not clear from the bed report that steroid immunosuppressants, the most common form of treatment, would be administered to this patient.
    [351] Sections from cirrhosis tissue were labeled with anti-α d antibodies in subpopulations of lymphocytes as well as foam cells in connective tissue between liver sinter nodes. The distribution of CD11c overlaps with but is not identical to α d expression. Anti-CD11c antibodies also labeled a subset of foam cells, but more macrophages and lymphocytes than anti-α d antibodies. There was no apparent overlap between the CD11a and CD11b expression distributions and the α d expression distribution.
    [352] Antibody 217L also stained phagocytic cells isolated by clustering from the populations identified by 212D and 217L. Antibodies against CD11b and CD11c stained 217L + clusters in different ways.
    [353] In a related experiment, antibodies 212D and 217L were used to stain human spleen tissue sections and serial sections of the spleen of non-human primate M. nemestrina. Splenocytes isolated from fresh human and monkey spleen tissues were also evaluated by flow cytometry for α d expression. Both antibodies 212D and 217L recognized human and monkey splenocytes. According to both ICC and FACS, the α d + population accounted for about 20% of the total cells, which was different from rodents showing more proportions of ad + cells. Positive populations were found to be identical in form to macrophages.
    [354] Human bone marrow staining
    [355] Human bone marrow samples were obtained from the long bones of healthy bone marrow donors according to standard techniques. The original sample was diluted 1: 3 in iscove medium and centrifuged at 200 RPM for 20 minutes. The buffy coat layer was carefully collected, washed once and hemolyzed using hemolysis buffer (0.83% ammonium chloride, 0.1% sodium bicarbonate, no EDTA). Cells were resuspended in PBS containing 15% FBS, aliquoted at 100,000 cells per 100 μl tube and stored on ice. Immunostaining was performed as known. In summary, monoclonal mouse anti-human α d antibody 212D or 217L or mouse anti-human CD18 or mouse anti-human CD50 (ICAM-R specific) antibody were individually added to each cell sample with a final concentration of 10 μg / ml. And the mixture was incubated for 20 minutes on ice. Cells were washed twice and further incubated with goat anti-mouse FITC for 20 minutes. Cells were washed twice and resuspended in 1% paraformaldehyde. Fluorescence was measured using a fluorescence activated cell sorter FACSCAN (Becton Dickinson).
    [356] The results of the four experiments showed that 13-43% (median 27%) of the α d expression measured using antibody 212D was observed in the cells, and 6-55% (median 21%) when measured using antibody 217L. Appeared to be identified in the cells. CD18 expression was observed in 60-96% of cells (median 71%) and CD50 expression was observed in 86-99% (median 94%) of cells.
    [357] Α on peripheral blood dExpression of
    [358] Monocyte Cells from Breast Cancer Patients
    [359] Peripheral blood mononuclear cells were isolated using picol separation of blood samples from high-risk breast cancer patients, ie breast cancer patients with poor prognostic characteristics of bone marrow transplantation. Cells were screened by immunostaining for α d expression as described above.
    [360] As a result, α d expression measured using antibody 212D was confirmed in 20% of cells, and expression measured using antibody 217L was confirmed in 13% of cells. Antibody 212D also stained a subset of small cells likely to be lymphocytes. The proportion of cells expressing a d was similar to the rate generally observed in normal blood donors.
    [361] In addition, antibody 212D has been shown to stain large cells that are CD14 + as well as much smaller cells that are uncertain but are identified as CD3 + . This result was observed in both blood and bone marrow.
    [362] The variation in the number of cells expressing a d may be attributed to the difference in cell composition of the bone marrow aspirate between donors (eg, the amount of bone marrow compared to the amount of circulating blood).
    [363] Example 19
    [364] α dUpregulation of expression
    [365] Leukocyte integrins are generally upregulated during hemodialysis and are responsible for the immunomodifications observed in chronic renal failure [Rabb, et al., J. Am. Soc. Nephrol. 6: 1445-1450 (1995) and Rabb, et al., Am. J. Kidnet Dis. 23: 155-166 (1994)], α d / CD18 surface expression during hemodialysis and in the case of febrile renal failure. In addition, expression of α d / CD18 in vitro was also examined after PKC stimulation.
    [366] Whole blood samples were obtained from hospital patients without five randomly selected kidney disease. Prior to surface staining and flow cytometry, blood samples were incubated with 50 ng / ml PMA for 30 minutes at 37 ° C. Blood was collected from patients with chronic renal failure. The patient was a stable nondiabetic patient who received dialysis three times a week. Reference samples were taken prior to the start of dialysis and additional samples were taken at 15 and 180 minutes during dialysis through the cupropanme. Blood samples were taken from normal subjects with no known disease and used as negative controls.
    [367] For cell staining, 5 μg of antibodies 169A and 169B (and negative control 1B7) were incubated with 100 μl of whole blood in the dark for 15 minutes. Becton Dickinson lysis reagent (2 mL) was added to each mixture and incubated for 10 min in the dark. Cells were then pelleted and suspended in PBS. Cells were pelleted again by centrifugation, mixed with secondary FITC-conjugated antibody and incubated for 30 minutes in the dark. Cells were then washed with PBS, centrifuged, aspirated and resuspended in 1.0% formalin.
    [368] Rabb et al., J. Am. Soc. Nephrol. 6: 1445-450 (1995)] was used to perform flow cytometry. Samples were analyzed using Simulset software (Becton Dickinson) on a FACScan flow cytometer (Becton Dickinson). At least 22,000 cells were analyzed for each sample. Granulocyte, monocyte and lymphocyte subsets were gated with forward scattering and lateral scattering. Purity of the cell subsets was assessed by CD45 staining and CD14 staining.
    [369] The results suggest that α d / CD18 expression can be detected in samples taken from normal human subjects; This expression was maximal in monocytes and minimal in lymphocytes. The expression in neutrophils was intermediate between monocytes and lymphocytes. Staining with antibody 169B was weaker than staining with antibody 169A. PMA treatment upregulated α d / CD18 expression, particularly in neutrophils and monocytes.
    [370] Α d / CD18 expression in samples from renal failure patients was detectable in neutrophils, monocytes and lymphocytes prior to initiation of dialysis. After 15 minutes of dialysis with the leukocyte activating membrane, a slight increase in α d / CD18 expression was detected. At the end of treatment the expression in monocytes and lymphocytes was substantially reduced. This result suggests that α d / CD18 expression is different from that observed for CD11a / CD18, CD11b / CD18, and L-selective expression after dialysis.
    [371] Example 20
    [372] Isolation of Rat cDNA Clone
    [373] Considering the presence of α d subunits in both canine and human, we attempted to isolate homologous genes in other species, including rats (example) and mice (example 20, below).
    [374] A partial sequence of rat cDNA showing homology to the human α d gene was obtained from the rat spleen λgt10 library (Clontech). Libraries were plated at 2 × 10 4 pfu / plate on 150 mm LBM / agar plates. Standard protocol [Sambrook, et al, Molecular Cloning: a laboratory manual, p. 2.110, the library was lifted on a Hybond® membrane (Amersham), denatured for 3 minutes, neutralized for 3 minutes and washed with buffer for 5 minutes. The membrane was immediately placed in the strata linker (Stratagen) and the DNA was crosslinked by autocrosslinking setup. The membranes were prehybridized and hybridized in 30% or 50% formamide, respectively, for low and high string conditions. Membranes were initially screened using P 32 labeled probes formed from human α d cDNA, corresponding to bases 500-2100 of clone 19A2 (SEQ ID NO: 1). Probes were labeled using a Schöllinger Mannheim random prime kit according to the manufacturer's suggested protocol. The filter was washed with 2 x SSC at 55 ° C.
    [375] Two clones were identified named 684.3 and 705.1 which showed sequence homology to human α d , human CD11b and human CD11c. Two clones were aligned to the human α d gene in the 3 ′ region of the gene starting at base 1871 for clone 684.3 and extending to base 3012 for clone 705.1 and for genes 1551 to 3367 for clone 705.1.
    [376] To isolate more complete rat sequences comprising the 5 'region, the same protocol was used as was used for the initial screening, but the same library was rescreened using mouse probes formed from clone A1160 (see Example 20, below). . Single isolated plaques from the second screening were selected and maintained as a single clone in the LBM / agar plate. DNA for sequencing was formed using sequencing primers 434FL and 434FR (SEQ ID NOs: 34 and 35, respectively) in a standard PCR protocol.
    [377] 5'-TATAGACTGCTGGGTAGTCCCCAC-3 '(SEQ ID NO 34)
    [378] 5'-TGAAGATTGGGGGTAAATAACAGA-3 '(SEQ ID NO: 35)
    [379] DNA obtained from PCR was purified using a quick spin column (Qiagen) according to the manufacturer's protocol.
    [380] Two clones (741.4 and 741.11) were identified that overlap with clones 684.3 and 705.1. In the overlapping regions, clones 741.1 and 741.11 had 100% homology to clones 684.3 and 705.1. Complex rat cDNA having homology to the human α d gene is disclosed in SEQ ID NO: 36, and putative amino acid sequence is shown in SEQ ID NO: 37.
    [381] Rat αdCloning of the 5 'End of the
    [382] The 5 'cDNA fragment for the rat α d gene was obtained using the Clontech rat spleen RACE cloning kit according to the manufacturer's suggested protocol. The gene specific oligonucleotides used were named 741.11 # 2R and 741.2 # 1R (SEQ ID NOs: 59 and 58, respectively).
    [383] 5'-CCAAAGCTGGCTGCATCCTCTC-3 '(SEQ ID NO: 59)
    [384] 5'-GGCCTTGCAGCTGGACAATG-3 '(SEQ ID NO: 58)
    [385] Oligo 741.11 # 2R includes the base pair 131-152 of SEQ ID NO: 36 in the reverse direction, and 741.2 # 1R also includes the base pair 696-715 of SEQ ID NO: 36 in the reverse direction. Primary PCR was performed using 31.2-outermost oligo 741.2 # 1R. Secondary PCR was performed using DNA generated from the first reaction and oligo 741.11 # 2R. A band of about 300 base pairs was detected on a 1% agarose gel.
    [386] The secondary PCR product was ligated with plasmid pCRTAII (Invitrogen) according to the manufacturer's suggested protocol. White (positive) colonies were taken and added to 100 μl of LBM containing 1 μl of 50 mg / ml carbenicillin stock and 1 μl of M13 K07 phage culture in each well of a round bottom 96 well tissue culture plate. The mixture was incubated at 37 ° C. for 30 minutes to 1 hour. After the initial incubation period, 100 μl of LBM (containing 1: 250 dilution of 10 mg / ml kanamycin stock and 1 μl of 50 mg / ml carbenicillin) was added and incubation was continued at 37 ° C. overnight.
    [387] Supernatants from 96 well plates were transferred to four Amersham Hybond® nylon filters using a pointed instrument for sterile 96 well metal delivery. Filters were modified, neutralized and crosslinked by standard protocols. Filters were prehybridized in 20 ml of prehybridization buffer (5 × SSPE; 5 × Denhardt; 1% SDS; 50 μg / ml denatured salmon sperm DNA) for several hours at 50 ° C. with shaking.
    [388] Oligo probes 741.11 # 1 and 741.11 # 1R (SEQ ID NOs 56 and 57, respectively) comprise base pairs 86-105 (SEQ ID NO: 36) in the forward and reverse directions, respectively, and are labeled as follows.
    [389] 5'-CCTGTCATGGGTCTAACCTG-3 '(SEQ ID NO: 56)
    [390] 5'-AGGTTAGACCCATGACAGG-3 '(SEQ ID NO 57)
    [391] About 65 WP oligo DNA in 12 μl dH 2 O was heated to 65 ° C. for 2 minutes. 3 μl of 10 mCi / ml γ- 32 P-ATP was added to the tube with 4 μl 5 × Kinase buffer (Gibco) and 1 μl T4 DNA kinase (Gibco). The mixture was incubated at 37 ° C. for 30 minutes. After incubation, 16 μl of each labeled oligo probe was added to prehybridization buffer and filter and hybridization continued at 424 overnight. Filter at 5 × SSPE at room temperature; Washed three times with 0.1% SDS, the running time per wash was 5 minutes. Autoradiography was then taken for 6 hours. Positive clones were propagated and DNA purified using Magic Mini Prep Kit (Promega) according to the manufacturer's suggested protocol. Clone 2F7 was selected for sequencing, which had 100% homology to clone 741.11 in the overlapping region. The complete rat α d nucleic acid sequence is disclosed in SEQ ID NO: 54 and the amino acid sequence is disclosed in SEQ ID NO: 55.
    [392] Characterization of Rat cDNA and Amino Acid Sequences
    [393] Neither nucleic acids nor amino acids have been reported for rat α subunits in β 2 integrins. However, sequence comparisons to the reported human β 2 integrin α subunits suggest that isolated rat clones and their putative amino acid sequences are most closely related to α d nucleotides and amino acid sequences.
    [394] At the nucleic acid level, the isolated rat cDNA is 80% identical to human α d cDNA, 68% identical to human CD11b, 70% identical to human CD11c, and 65% identical to mouse CD11b Indicates. Compared with human CD11a and mouse CD11a, no significant identity was found.
    [395] At the amino acid level, the putative rat polypeptide encoded by the isolated cDNA is 70% identical to human α d polypeptide, 28% identical to human CD11a, 58% identical to human CD11b, compared to human CD11c 61% identity, 28% identity compared to mouse CD11a and 55% identity compared to mouse CD11b.
    [396] Example 21
    [397] α dNorthern analysis of rat tissue for expression
    [398] RNA was taken from Lewis rat tissue panels and subjected to northern analysis using a rat α d probe. Samples, normal spleen, brain, spinal cord, thymus, skin, small intestine, and rat antigen took on activated T cells and disease EAE (experimental allergic encephalomyelitis) Normal addition to poly (A +) RNA taken from the spleen and lymph nodes, spleen, kidney And total RNA taken from liver, lung, and bone marrow. The experiment was carried out using the technique disclosed in Example 6.
    [399] The α d probe was selected from the rat cDNA region comprising nucleotides 1184 to 3008 of SEQ ID NO: 54, indicating the region with the lowest homology with rat CD11c and rat CD11b. 10 μg of rat α d cDNA clone 684.3 was restriction enzyme digested with Eco R1 to form a 1124 bp probe. Fragments were gel purified and used for random primed labeling reactions as described in Example 6. Northern blots were prehybridized, hybridized and washed as described in Example 6 except the probe was added to hybridization buffer at 5.5 × 10 5 cpm / ml.
    [400] After 5 days of autoradiography, bands were detected in lanes containing poly (A + ) RNA and total spleen RNA from normal rats, as well as spleen from active EAE rats, with a greater amount of RNA than normal spleen. . The detected transcript size was consistent with the size of the full length rat cDNA clone.
    [401] Example 22
    [402] Rat α dRodent α for I Domain / Hu IgG4 Fusion Protein dPreparation and Characterization of -Specific Antibodies-Antibodies
    [403] Given the fact that the I domain of human β 2 integrins proved to precipitate upon ligand binding, it was assumed to be the same for the rat α d protein. Thus, monoclonal antibodies immunospecific to the rat α d I domain would be useful in rat models of human disease states involving α d binding.
    [404] Oligo "rat alpha-DI5" (SEQ ID NO: 87) and "rat alpha-DI3" (SEQ ID NO: 88) from the rat α d sequences corresponding to base pair 469-493 and base pair 1101-1125 (reverse direction) of SEQ ID NO: 54, respectively Formed. This oligo was used in a standard PCR reaction to form a rat α d DNA fragment containing an I domain spanning base pairs 459-1125 of SEQ ID NO: 54. PCR products were ligated with the vector pCRTAII (Invitrogen) according to the manufacturer's suggested protocol. Positive colonies were selected and grown for DNA purification using Qiagen (Catworth, GA) midi prep kit according to the manufacturer's suggested protocol. DNA was digested with Xho I and Bgl II in standard restriction enzyme digest, 600 base pair bands gel purified and ligated with pDCS1 / HuIgG4 expression vector. Positive colonies were selected, propagated and DNA purified using the Qiagen Maxi Prep Kit.
    [405] COS cells were plated at 1/2 total growth in a 100 mm culture dish and grown overnight at 37 ° C. in 7% CO 2 . Cells were washed once with 5 ml DMEM. To 5 ml DMEM was added 50 μl DEAE-dextran, 2 μl chloroquinone and 15 μg of rat α d I domain / HuIgG4 DNA as described above. The mixture was added to COS cells and incubated at 37 ° C. for 3 hours. The medium was then removed and 5 ml of 10% DMSO in CMF-PBS was added for exactly 1 minute. The cells were washed briefly with DMEM once. 10 ml DMEM containing 10% FBS was added to the cells and continued incubation overnight at 37 ° C. in 7% CO 2 . The next day, the medium was replaced with fresh medium and incubated for 3 more days. Medium was collected and fresh medium was added to the plate. After 3 days, the medium was collected again and the plate was discarded. The procedure was repeated until 2 L of culture supernatant was collected.
    [406] The supernatants collected as described above were loaded onto a ProsepA® column (Bioprocessing Limited) and protein purified as follows.
    [407] The column was initially washed with 15 column volumes of wash buffer containing 35 mM Tris and 150 mM NaCl, pH 7.5. The supernatant was loaded at a slow rate up to about 60 column volumes per hour. After loading, the column was washed with 15 column volumes of wash buffer, 15 volumes of 0.55 M diethanolamine (pH 8.5) and 15 volumes of 50 mM citric acid (pH 5.0). The protein was eluted with 50 mM citric acid, pH 3.0. Proteins were neutralized with 1.0 M Tris, pH 8.0 and dialyzed in sterile PBS.
    [408] Rat α d I domain proteins were analyzed as described in Example 14. The detected protein was moved in the same manner as observed using the human I domain protein.
    [409] Rat αdMonoclonal Antibody Generation Against I Domain / HuIgG4 Fusion Proteins
    [410] Mice were individually immunized with purified rat α d I domain / HuIgG4 fusion proteins pre-emulsified in the same volume of Freund's Complete Adjuvant (FCA) (Sigma). About 200 μl of the antigen / adjuvant preparation was injected into the back of each mouse and 4 sites. After two more weeks, mice were further stimulated by injection of 100 μl (50 μg / mouse) of pre-emulsified rat α d I domain / HuIgG4 antigen in the same volume of Freund incomplete adjuvant (FIA). Two weeks later, mice were further stimulated with 50 μg antigen in 200 μl PBS injected intravenously.
    [411] To assess serum titers of immunized mice, orbital posterior hemorrhage was performed in animals 10 days after the third immunization. Blood was coagulated and serum was separated by centrifugation. This serum was used for immunoprecipitation in biotinylated (BIP) rat splenocytes. Serum from each mouse immunoprecipitated protein bands with putative molecular weights for rat α d and rat CD18. One mouse was selected for fusion and the fourth additional stimulation was performed as described above for the third additional stimulation.
    [412] Hybridoma supernatants were screened by antibody capture as follows. Chlorine anti-mouse IgA, IgG or IgM (Organone) diluted Immulon® 4 plate (Dynatech, Cambridge, Mass.) Diluted 1: 5000 at 4 ° C., 50 mM carbonate buffer, pH 9.6. Technica) 50 μl / well. Plates were washed three times with PBS (PBST) containing 0.05% Tween 20 and 50 μl culture supernatant was added. After incubation at 37 ° C. for 30 min and washing as described above, 50 μl of horseradish peroxidase-conjugated goat anti-mouse IgG9 (Fc) diluted 1: 3500 in PBST (West, Pennsylvania, USA) Grove Jackson Immun Research) was added. Plates were incubated as described above and washed four times with PBST. Immediately thereafter, 100 μl of substrate containing 1 mg / ml o-phenylene diamine (Sigma) and 0.1 μl / ml 30% H 2 O 2 in 100 mM citrate, pH4.5 was added. The color reaction was stopped 5 minutes after the addition of 50 μl of 15% H 2 SO 4 . Absorbance at 490 nm was read in a Dynatech reader.
    [413] Supernatants obtained from antibody containing wells were analyzed by ELISA using immunized rat α d I domain / HuIgG4 fusion proteins. ELISA with HuIgG4 antibody coatings served as a control of responsiveness to IgG fusion partners. Positive wells were selected for further screening by BIP in rat splenocyte lysates using the technique described below.
    [414] Rat α dPreparation of Polyclonal Serum for I Domain / HuIgG4 Fusion Proteins
    [415] Two rabbits were pre-bleeded and then immunized with 100 μg of purified rat α d I domain / HuIgG4 fusion protein in complete Freund's adjuvant. The same dose in incomplete Freund's adjuvant (IFA) was repeated every three weeks. After three injections, rabbits were bled test and the serum collected was used for standard immunoprecipitation in rat splenocyte lysates. Serum from two rabbits was immunized with rat α d . Rabbits were further challenged with 100 μg antigen in IFA and harvested serum was analyzed for increased immunoreactivity with rat α d by immunoprecipitation. Animals were bled 10 days after the last additional challenge and serum collected.
    [416] Rat α dhistology
    [417] Rabbit polyclonal sera formed against the rat α d “I” domains were used for immunochemical staining of rat tissue sections by the technique disclosed in Example 18. The staining pattern detected in frozen rat spleen fragments and paraffin embedded rat spleen fragments was almost similar to that observed with antibodies to human α d , and each cell of red stroma was stained. Staining patterns were different from those observed with monoclonal antibodies against rat CD11a, CD11b and CD18. In addition, a positive staining pattern was observed in the thymus of each cell of the cortex. These tissues did not show any signal when stained with rabbit pre-immune serum.
    [418] Antibody Specificity Assay
    [419] Rats were sacrificed by choking with CO 2 and spleens were removed using standard surgical procedures. Splenocytes were harvested by gently pushing the spleen through a wire mesh with a 3cc syringe plunger in 20 ml RPMI. Cells were harvested in 50 ml conical tubes and washed in appropriate buffer.
    [420] The cells were washed three times with cold D-PBS and resuspended at 10 8-10 9 cell density in 40 ml PBS. 4 mg NHS-Biotin (Pierce) was added to the cell suspension and the reaction continued for exactly 15 minutes at room temperature. Cells were pelleted and washed three times in cold D-PBS.
    [421] Cold lysis buffer ((1% NP40; 50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 2 mM CaCl; 2 mM MgCl; 1: of pepstatin, leupetin and aprotinin added immediately before being added to cells) Cells were resuspended at a density of 10 8 cells / ml in 100 solutions; 0.0001 g PMSF crystals added immediately before addition to the cells Vortex the lysate for about 30 seconds, incubate for 5 minutes at room temperature, and on ice Further incubation for 15 minutes Insoluble material was pelleted by centrifuging the lysate for 10 minutes at 10,000 x g The supernatant was collected in unused tubes and stored at 4-20 ° C.
    [422] 1 ml of cell lysate was incubated with 200 μl of Protein A Sepharose® slurry (Zyme) overnight at 4 ° C. prior to clarification. For each antibody to be tested, the clarified lysate was divided into Eppendorf tubes in an amount of 50 μl per Eppendorf tube. 25 μl of polyclonal serum or 100-500 μl of monoclonal antibody supernatant was added to the precleaned lysate and the resulting mixture was incubated for 2 hours at 4 ° C. with rotation. 100 μl of rabbit anti-mouse IgG (Jackson) bound to Protein A Sepharose® beads in PBS slurry was added and continued incubation for 30 minutes at room temperature with rotation. The beads were pelleted by light centrifugation and washed three times with cold wash buffer (10 mM HEPES; 0.2 M NaCl; 1% Trition X-100). Aspirate was removed and 20 μl of 2 × SDS sample buffer containing 10% β-mercaptoethanol was added. Boil the sample for 2 minutes in a water bath and load the sample on a 5% SDS PAGE gel. After separation, the protein was transferred to nitrocellulose overnight at a constant rate. The nitrocellulose filter was blocked with 3% BSA in TBS-T for 1 hour at room temperature and the blocking buffer was removed. A 1: 6000 dilution of streptavidin-HRP conjugate (Jackson) in 0.1% BSA TBS-T was added and continued incubation for 30 minutes at room temperature. Each time, the filter was washed three times for 15 minutes with TBS-T and autoradiography was performed using the Amersham ECL kit according to the manufacturer's protocol.
    [423] Full length rat α dMonoclonal Antibody Production Against Proteins
    [424] Rat α d was purified from rat splenocytes to prepare immunogens for forming anti-rat α d monoclonal antibodies. Spleens were taken from 50 normal female Lewis rats 12-12 weeks of age and forced into a micronet screen to prepare a single cell suspension from tissue. Red blood cells were removed by cell lysis in a buffer containing 150 mM NH 4 Cl, 10 mM KHCO 3 , 0.1 mM EDTA, pH7.4, and the remaining white blood cells were washed twice with phosphate buffered saline (PBS). The splenocytes are pelleted by centrifugation and containing 50 mM Tris, 150 mM NaCl, 2 mM CaCl 2 , 2 mM MgCl 2 , 10 mM PMSF, leupetin, pepstatin and 1% Triton X-100®. It was dissolved in buffer. Splenocyte lysis was performed on ice for 30 minutes using 1 ml of lysis buffer per 5 x 10 8 splenocytes. Centrifugation removed the insoluble material.
    [425] CD11a, CD11b and CD11c were removed from splenocyte lysates by immunoprecipitation as follows. 750 μl of Protein A-Sepharose® slurry was incubated with 2 mg rabbit anti-mouse immunoglobulin at 4 ° C. for 30 minutes. Rabbit anti-mouse-protein A-Sepharose® was washed three times with lysis buffer and suspended in a final volume of 1.5 ml of lysis buffer. Rat spleen lysate of about 200 μg of rat β 2 integrin specific monoclonal antibodies 515F (specific to rat CD11a), OX-42 (specific to rat CD11b) and 100 g (specific to rat CD11c), respectively To 50 ml. After 30 minutes of incubation at 4 ° C., 500 μl of rat anti-mouse-protein A-Sepharose® was added to the spleen lysate and end-over-end rotation at 4 ° C. for 30 minutes. Mixed. The lysates were centrifuged at 2500 × g for 10 minutes to pellet CD11a, CD11b and CD11c bound to rabbit anti-mouse-protein A-Sepharose® and the supernatant was transferred to a clean 50 ml centrifuge tube. Immunoprecipitation with antibody 515F, OX-42 and 100 g was repeated two more times to completely remove CD11a, CD11b and CD11c.
    [426] Affinity purification was used to isolate β 2 integrins remaining in the lysate. About 250 μl of a slurry of anti-rat CD18 monoclonal antibody 20C5B conjugated to CNBr-Sepharose® was added to the lysate and mixed at 4 ° C. for 30 min. The antibody / antigen complex was pelleted by centrifugation at 2500 xg for 10 minutes and the pellet washed three times with lysis buffer and stored at 4 ° C.
    [427] Immunization of Armenian Hamsters
    [428] 1. 6-8 week old Armenian husters were initially immunized with about 50 μg recombinant protein consisting of rat α d I domains fused to human IgG 4 heavy chains emulsified in complete Freund's adjuvant. After the first immunization, on day 14, 33 and 95, subsequent immunization was performed with rat α d I domain / HuIgG 4 emulsified in incomplete Freund's adjuvant. Two separate fusions, named 179 and 199, were performed in series.
    [429] Four days prior to fusion 197 (306 days), one hamster received a combination of rat α d protein purified from splenocytes and CHO cells transfected with rat α d . Three days prior to fusion (307 days), purified rat α d protein and α d transfected CHO cells were provided to provide additional fusion stimulation. Rat α d transfected CHO cells were prepared as described below.
    [430] Gene segments encoding full-length rat α d proteins were inserted into the pDC1 vector and electroporated to transfect CHO cells with human CD18-pRC constructs. Transfected cells were propagated in the presence of hipoxanthin to select cells that were successfully transfected by the pRC construct and expanded in the presence of g418 to select cells transfected with the pDC1 construct. After 3 weeks, cells were stained with rat α d specific rabbit polyclonal serum and sorted by FACS. Small proportions of cells expressing the highest amount of surface α d (about 3% of the total group) were harvested and further propagated. FACS selection was repeated several times to provide a cell population with a high amount of α d surface expression.
    [431] Α d transfected cells were characterized by flow cytometry using rat α d specific polyclonal serum and TS1.18.1, a human CD18 specific monoclonal antibody. From the results, it was confirmed that the transfected CHO cells express large amounts of both rat α d and human CD18.
    [432] Finally, α d and CD18 expression in cells were assessed by immunoprecipitation. Rat α d specific rabbit polyclonal serum was found to immunoprecipitate proteins with two characteristic molecular weights. The higher molecular weight protein (s) is about 170 kD and the lower molecular weight protein (s) is 95 kD. This finding was consistent with the expression of rat α d / human CD18 heterodimer complex on the surface of transfected CHO cells.
    [433] On the day of fusion, the spleen was removed and soaked in serum-free RPMI 1640 supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units / ml penicillin and 100 μg / ml streptomycin (RPMI) (Gibco, Canada). Tissues were ground between the degreasing ends of two glass microscope slides to form a single cell suspension. Filter the cell suspension through a sterile 70-mesh Nitex cell strainer (Becton Dickinson, Pasipani, NJ), centrifuge at 200 xg for 5 minutes, resuspend the pellet in 20 ml serum-free RPMI Washed twice. Thymic cells taken from three Balb / c mice that were never exposed to antigen were prepared in a similar manner. 200 × g of NS-1 myeloma cells maintained in logarithmic phase in RPMI with 10% petaclon serum (FBS) (Hyclone Laboratories Inc., Logan, Utah) for 3 days prior to fusion. Centrifuge at and wash the pellet twice as described above.
    [434] About 1.15 × 10 8 spleen cells were mixed with 5.8 × 10 7 NS-1 cells, centrifuged and aspirated to remove supernatant. Tap the tube to remove the cell pellet and add 7 ml of 37 ° C. PEG 1500 (50% in 75 mM Hepes, pH 8.0) (Möllinger Mannheim) over 1 minute with stirring and serum-free RPMI 14 over 7 minutes Ml was added. Further 8 ml RPMI was added and cells were centrifuged at 200 x g for 10 minutes. The supernatant was removed, 15% FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units / ml IL-6 (Bollinger Mannheim) and 1.5 × 10 The pellet was resuspended in 200 ml RPMI containing 6 thymic cells / ml. Dispense the suspension into 10 96-well flat bottom tissue culture plates (Corning, UK) at 200 μl / well, then aspirate about 100 μl from each well using an 18 G needle (Becton Dickinson) and detect thymic cell deprivation. Except for 100 μl of the culture medium as described above, cells were fed 4, 5, 6 and 7 days after fusion.
    [435] On day 10, supernatants from fusion wells were screened by flow cytometry for responsiveness to rat α d / human CD18 transfected CHO cells. About 5 × 10 5 rat α d transfected CHO cells were suspended in 50 μl RPMI containing 2.0% FBS and 0.05% sodium azide and added to about 100 μl of hybridoma culture supernatant in a 96 well round bottom plate. Positive controls for staining included rabbit anti-α d polyclonal serum and TS1 / 18 (anti-human CD18). Cells were incubated on ice for 30 minutes, washed three times in FACS buffer (RPMI, 2.0% FBS, 0.05% NaAzide) and FITC-conjugated goat anti-hamster antibody (final dilution 1: 200 in FACS buffer). Incubated for 30 minutes on ice with Jackson Immunore Research Labs. Cells were washed three times in FACS buffer and resuspended in 200 ml of FACS buffer. Samples were analyzed with a Beckton Dickinson FACscan analyzer. The screen was repeated with untransfected CHO cells so that the positive clone wells were specific for rat α d . Wells that meet the criteria for reacting with rat α d CHO transfectants and wells that were not transfected CHO cells were cloned.
    [436] After primary screening, cells from positive wells were cloned by initially diluting and limiting dilution in RPMI, 15% FBS 100 mM sodium hypoxanthine, 16 mM thymidine, and 10 units / ml IL-6. . In the limiting dilution step, the proportion of wells showing proliferation was measured and clonality was estimated using Poisson distribution analysis. Wells showing proliferation were analyzed by FACS after 10-12 days. After final cloning, positive cells were propagated in RPMI and 11% FBS. Cloning yielded one culture that was presumed positive by these criteria, and four separate subclones, named 197A-1, 197A-2, 197A-3, and 197A-4, were grown.
    [437] Prior to fusion 199, the second hamster was further stimulated at 307 days with 2.3 × 10 6 rat α d (RAD) -transfected CHO cells. Two final immunizations were performed 4 days before fusion (334 days) and again 3 days before fusion (335 days). Additional stimulation at day 334 consisted of 2 × 10 6 rat α d transfected CHO cells administered with intraperitoneal injection and 200 μl of purified rat α d bound to Sepharose® (described above). Additional stimulation at day 335 consisted of 5 × 10 6 rat α d transfected CHO cells administered by intraperitoneal injection. The fusion and screening protocols for fusion 199 are identical to fusion 197 and were cloned by identifying three hybridomas designated 199A, 199H, and 199M using supernatants that are reactive with rat α d .
    [438] 2. A second immunization was performed using the same protocol to induce fusions 197 and 199. After 334 additional stimuli, there were no additional immunizations until 394 and 395 days. Prior to fusion, the hamsters were administered 2 × 10 6 RAD-transfected CHO cells with 300 μl of purified rat α d -Seraphos® administered by intraperitoneal injection. The fusion and screening protocols for subsequent fusion 205, fusions 199 and 197, except that the cloning procedure used an Armenian hamster ELISA reagent such as goat anti-Armean hamster antibody (Jackson Immunoresearch Labs) as the initial screen. Was the same as Positive cells identified by this method were then screened by FACS as disclosed. Fusion 205 Results Three distinct positive clones, named 205A, 205C, and 205E, were obtained.
    [439] 3. Another method of producing anti-rat α d monoclonal antibodies, comprising 6-12 weeks old BALB on day 1 with purified rat α d -sepharose® administered subcutaneously in complete Freund's adjuvant. / c mice were immunized. On day 25, secondary antigenic stimulation was performed using the same immunogen in incomplete Freund's adjuvant with the same route. The same tertiary stimulus was performed at 42 days as the second stimulus. No further antigenic stimulation was performed after pre-fusion stimulation consisting of 400 μl (fusion 226) and 250 μl (fusion 236) purified rat α d -Sepharose® injected intraperitoneally. Each volume contained about 10-15 μg antigen as determined by Cosami staining. Additional antigenic stimulation prior to fusion for 226 was performed on days 62 and 63 and fusion was on day 66. For fusion 236, additional antigenic stimulation was performed at 132 and 133 days before fusion and at 136 days. The two fusion protocols differ from the protocols used for the Armenian hamster fusion in that the ratio of splenocytes: NS-1 cells in the Armenian hamster fusion is 2: 1, whereas it is 5: 1. Otherwise the fusion protocol was identical to the Armenian hamster protocol.
    [440] Screening and cloning protocols for fusions 226 and 236 were the same as for fusions 197, 199, and 205 except that an initial screen by ELISA was performed. In ELISA, mouse antibodies were captured from the hybridoma supernatant using goat anti-mouse whole molecules and mouse antibodies were detected using goat anti-mouse horseradish peroxidase conjugates. Positive supernatants were then screened by FACS as disclosed for fusions 197-205.
    [441] Fusion 226 yielded nine positive clones named 226A, 226B, 226C, 226D, 226E, 226F, 226G, 226H, and 226I. Fusion 236 yielded 10 positive clones named 236A, 236B, 236C, 236F, 236G, 236H, 236I, 236K, 236L, and 236M. Monoclonal antibodies resulting from these clones were isotyped by ELISA as described in Example 15. All antibodies were found to be IgG1 isotypes.
    [442] Rat α dCharacterization of monoclonal antibodies against
    [443] To characterize anti-rat α d antibodies, biotin labeled spleen lysates were prepared as described in Example 22, Section D above. Lysates were precleaned prior to use in immunoprecipitation. Initially, 50 μg / ml of normal rat immunoglobulin was added to the lysate and the resulting solution was mixed at 4 ° C. for 30 min in up-and-down rotation. 75 μl of a protein A-Sepharose® slurry coated with rabbit anti-mouse immunoglobulin was added and mixing continued for 30 minutes in vertical rotation. Rabbit anti-mouse coated Protein A beads were pelleted by centrifugation at 15,000 rpm with a table top microneedle tube at 4 ° C. for 5 minutes. The pelleted material was discarded.
    [444] For each cloned hybridoma, approximately 300 μl of supernatant was added to the Eppendorf microacupuncture tube, where 30 μl 10% Triton X-100®, 30 μl pepstatin, leupetin and aprotinin 100X. 50 μl of stock, 100 μg PMSF crystals and precleaned biotinylated rat spleen lysate were added. The sample was gently vortexed and placed on a vertical rotor at 4 ° C. for 30 minutes. A control sample was prepared by adding 10 mg / ml rabbit anti-rat α d specific polyclonal antibody to 50 μl of rat spleen lysate.
    [445] After 30 minutes of incubation, 75 μl of protein A-Sepharose® beads in the PBS slurry was added to each sample and incubated with rotation up and down at 4 ° C. for 30 minutes. Protein A-coupled beads were pelleted and centrifuged by centrifugation at 15,000 rpm in a table-top microneedle tube at 4 ° C. for 5 minutes. The pelleted beads were washed successively with the following series of 1 ml detergent washes. Buffer containing 10 mM Tris, 400 mM NaCl, 1.0% Triton X-100® pH 8.0 Buffer containing 1, 10 mM Tris, 400 mM NaCl, 0.5% Triton X-100®, pH 8.0 2, 10 mM Tris, 400 mM NaCl, 1.0% Triton X-100 (R), 0.1% deoxycholate, buffer 3 containing pH 8.0, 10 mM Tris, 400 mM NaCl, 0.5 M LiCl 2 , pH 8.0 Buffer containing 4. The final wash was carried out with Wash Buffer 1. The beads were gently vortexed between each wash and pelleted using a tabletop microacupuncture tube. The supernatant was removed with a transfer pipette and all buffer remaining with a Hamilton syringe after the final wash was removed from the beads. 50 μl aliquots of SDS sample buffer containing 10% final concentration of bromophenol blue and pyronin Y dyes and β-mercaptoethanol were added to each pellet. The mixture was vortexed vigorously for 1-2 minutes and incubated at room temperature for 5-10 minutes. Samples were centrifuged in a table-top microneedle tube at 4 ° C., 15,000 rpm for 5 minutes, and the released protein was collected and transferred to an unused microneedle tube. Aliquots from each sample were boiled in a water bath for 4 minutes and then loaded onto a 7.5% SDS-PAGE gel. After separation by PAGE, the protein was delivered to the nitrocellulose filter at 200 mAmp for 1 hour and the filter was blocked in 3.0% BSA / TBS-T solution at 4 ° C. overnight. 0.1% BSA-TBS-T solution containing streptavidin-OPD 1: 6000 dilution was added to each filter and incubated for 1 hour at room temperature. The filters were washed five times in TBS-T for 10 minutes each and developed using the Amersham ECL kit according to the manufacturer's suggested protocol.
    [446] Clone 199M was found to immunoprecipitate heterodimeric proteins. Larger protein subunits have an approximate molecular weight of 170-175 kD, consistent with the immunoprecipitated protein size by the rabbit anti-rat α d polyclonal control. The second protein precipitated at a molecular weight of about 95 kD, which is consistent with the molecular weight of CD18.
    [447] Example 23
    [448] Specificity of Monoclonal Antibody 199M
    [449] Affinity purification of rat α d from splenocyte lysates was performed using conjugated 199M monoclonal antibody and CNBr-Sepharose® affinity column. In brief, about 1.3 × 10 10 rat spleen cells were lysed in a buffer consisting of 150 mM NaCl, 10 mM PMSF, 10 mM Tris, 1% Triton X-100, pH 8.0. Cells in buffer were incubated for 30 minutes on ice and centrifuged at about 10,000 × g for 30 minutes at 4 ° C.
    [450] Antibody 199M was conjugated to CNBr-activated Sepharose® 4B (Pharmacia) in the following manner. 1 g of activated resin was suspended in 1 mM HCl for 15 minutes, washed three times with 15 ml of 1 mM HCl, and once with 15 ml of coupling buffer containing 0.1 mM HC0 3 , 0.5 M NaCl, pH 8.0. Antibody 199M in coupling buffer was added to the resin suspension at a final concentration of about 10-20 mg / ml and the mixture was incubated overnight at 4 ° C. The next day, the bonded resin was pelleted by centrifugation and the supernatant was removed. Incubated at 0.1 M Tris, pH 8.0 for 1 hour at room temperature to block dendritic unreacted groups. The conjugated resin was washed with 0.1 M citric acid, pH 3.0 and stored in lysis buffer as a 1: 2 slurry containing 0.1% sodium azide.
    [451] For affinity purification, splenocytes were incubated overnight with up-down mixing with 0.4 ml of 199M conjugated Sepharose® resin. The resin was then pelleted by centrifugation and washed four times with 15 ml lysis buffer. Aliquot about 100 μl of each gel in reducing sample buffer containing 0.1 M Tris-HCl, pH 6.8, 2.0% SDS, 20% glycerol, 0.0002% bromophenol blue, 10% β-mercaptoethanol (5% final concentration). Was boiled for a while, loaded using 6.0% polyacrylamide SDS gel (SDS-PAGE) and protein separated.
    [452] Affinity purified materials were found to contain two major protein species and one minor protein species when isolated on SDS-PAGE. The major protein band with a molecular weight of 90 kD was consistent with the size of the known CD18, which was not sequenced. A second 160 kD major band was detected that matches the estimated molecular weight for α d . In addition, ancillary bands with an apparent molecular weight of 200 kD were also detected. Further analysis was performed by amino terminal sequencing for 160 kD and 200 kD species, and the results were compared with the amino acid sequences presumed by rat α d cDNA and the known amino acid sequences for CD11c and CD11b. The sequences of the 160 kD and 200 kD bands were found to match the amino acid sequences estimated by the cloned rat α d , suggesting that there are two forms of α d which are believed to result from splice variants or subglycosyl differences. It is.
    [453] Example 24
    [454] Rat α dT cell proliferation assay using -expressing macrophages
    [455] Macrophages expressing a d isolated from the rat spleen were used as antigen presenting cells (APCs) to stimulate the myelin basic protein specific T cell line designated LR-21. Briefly, rats were injected intravenously with a 100 μl volume of iron particles (Biomac, Cambridge, Mass.). The following day, single cell suspensions were prepared from the spleen and α d + macrophages phagocytic for iron particles were collected using magnets. Flow cytometry and immunoprecipitation revealed that 50-80% of iron-fed cells were α d + .
    [456] This suggests that splenic macrophages expressing α d are very poor APCs compared to other APCs such as thymic macrophages. Monoclonal antibodies, designated 205C, were tested in proliferation assays with α d positive macrophages and LR-21 cell lines. Proliferation analysis was then performed as follows.
    [457] Spleen macrophages positive for α d expression were suspended at a density of 6 × 10 6 cells / ml in RPMI containing 5% normal rat serum and 100 μl of macrophage suspension was added to each well. Cells from LR-21 week were suspended at 1 × 10 6 cells / ml in RPMI with 5% normal rat serum and 50 μl of suspension was added to each well. Monoclonal antibody 205C was added to each well in 50 μl volume so that final concentrations were 50, 10 and 2 μg / ml. Plates were incubated at 37 ° C. for 72 hours and 1 μCi 3 H-thymidine was added for 24 hours of the last incubation process. Cells were harvested on a glass filter mat and 3 H incorporation was measured using a direct beta counter (Packard Matrix 96).
    [458] Experimental results show that high concentrations of antibody 205C (10 and 50 μg / ml) can reduce T cell proliferation in a dose dependent manner.
    [459] Example 25
    [460] Α derived from rat bone marrowdImmunoprecipitation of
    [461] Bone marrow cells were harvested from Lewis rats by rinsing the femur with PBS. Cells were washed, biotinylated and immunoprecipitated substantially as described in Example 18 using 20 μg purified monoclonal antibodies to immunoprecipitate proteins from 100 μl of precleaned cell lysate. . The immunoprecipitated protein was detected in the same manner as described above.
    [462] Rat α d monoclonal antibody 205C immunoprecipitated two bands shifted at 160 kD and 95 kD. This size band was consistent with the size for the α chain and β chain in α d / CD18 as observed in protein immunoprecipitation from splenocyte lysates using the same antibody. Antibodies to rat CD11a, CD11b or CD11c immunoprecipitated α chains other than α d , and all antibodies coimmunoprecipitated proteins with molecular weights consistent with those known for CD18.
    [463] Example 26
    [464] Α in animal models dExpression
    [465] Preliminary experimental results indicate that rat α d is selectively expressed by macrophage subpopulations, including cortical macrophages in the thymus, Cooper cells in the liver, perivascular cells of the central nervous system, subsets of peritoneal macrophages and resident bone marrow macrophages. Suggest that In addition, a subset of thioglycolate macrophages showed upregulation of α d expression following stimulation with dexamethasone. The observation of macrophage-limited expression of rat α d suggests that further expression analysis should be performed in various animal models.
    [466] Rat α in the Phenylhydrazine ModeldExpression of
    [467] Administration of phenylhydrazine to animals results in massive red blood cell (rbc) damage, resulting in transient ischemia. When the damaged rbc is removed from circulation by red stromal macrophages, significant splenic hypertrophy occurs. It is proposed that macrophages expressing a d may be involved in removing damaged rbc and other exogenous substances from circulation.
    [468] To test this hypothesis, rat groups were treated with saline alone or with phenylhydrazine dissolved in saline and administered by intraperitoneal injection at a dose of 100 mg / kg body weight. In some experiments, rats were treated with polyclonal antiserum formed against the “I domain” of rat α d .
    [469] Animals were killed at various time points after phenylhydrazine administration. Spleen weight and red blood cell volume were used as parameters of rbc clearance. Kidneys, spleens and livers were also harvested for histopathological evaluation, including immunostaining for CD11a, CD11b, CD11c and α d .
    [470] Overall observations showed that rats showed a sharp unloading zone and decreased red blood cell volume levels 4 days after treatment with phenylhydrazine (saline control and α d treatment). Treatment with α d polyclonal serum did not affect spleen weight or phenylhydrazine-induced erythrocyte volume reduction.
    [471] Tissues from phenylhydrazine treated rats for 4 days were sectioned to 4 μm thick and air dried in Superfrost Plus (VWR Scientific) at room temperature for 15 minutes. Before use, the slides were incubated at 50 ° C. for about 5 minutes. Sections were fixed in cold (4 ° C.) acetone (EM Science) at room temperature for 2 minutes and dried at room temperature. Sections were placed in 100 mL 1 × TBS, 1.1 mL 30% H 2 O 2 (Sigma), 1 mL 10% NaN 3 (Sigma) at room temperature for 15 minutes to remove endogenous peroxidase activity. Using a 150 μl solution containing 30% normal rat serum (Haran Bioproducts) and 2% BSA (Sigma) in 1X TBS, block each section for 30 minutes at room temperature, and then lightly dip the solution from the section. Removed. Each section received 75 μl biotinylated hamster anti-rat α d antibody 205C at a protein concentration of 13.3 μg / ml diluted in blocking solution for 1 hour at room temperature. After incubation, sections were washed three times, once for 5 minutes, in 1 × TBS to remove any unbound antibody. Excess TBS was removed by aspirating around the tissues after the final wash. Peroxidase conjugated goat anti-biotin antibody (Vector Laboratories) was diluted 1: 200 in blocking solution and 75 μl was added to each section for 30 minutes at room temperature. After incubation, slides were washed twice with 5 min once in 1 × TBS. AEC substrate (Vector Laboratories) was added and immersed in water to stop color development. Slides were counterstained with Gill's hematoxylin 2 (Sigma), washed with water and subsequently dehydrated in 70%, 95%, 100% EtOH, and xylene. The sections were then fixed with cytosyl chamber (VWR).
    [472] In saline treated rat spleen sections, most of the expression of α d is located in the splenic red stroma on morphologically identified cells, such as subpopulations of macrophages, granulocytes and lymphocytes. However, in phenylhydrazine treated rat spleens, the only cell type identified by the splenic red nucleus undergoing morphological changes was a large macrophage population that absorbed damaged red blood cells. Most of these giant macrophages were observed to express α d . In phenylhydrazine treated rats, it appears that the number of macrophages in splenic white matter expressing α d is increased.
    [473] Double labeling experiments were performed to determine the expression of α d and CD11c in phenylhydrazine treated rat spleens. As described above, α d expression was detected for macrophages of the splenic red stroma that appear to absorb damaged erythrocytes. CD11c expression was detected in macrophages of splenic red stroma and more reddish CD11c positive cells than α d positive cells. A small subset of α d positive macrophages not expressing CD11c was observed, but most macrophages expressing α d expressed CD11c. There was also a CD11c positive macrophage group that did not express α d .
    [474] Thus, immunohistochemical analysis suggests that on day 4 CD11c expression appears to be upregulated in the spleen of phenylhydrazine treated animals compared to saline controls. However, the expression of other integrins, CD11a, CD11b and α d does not appear to be affected by phenylhydrazine treatment. Treatment with polyclonal “I” domain α d antibodies did not affect the uptake of rbc by red stromal macrophages, but most macrophages that absorb rbc are α d positive. Α d positive macrophages absorbing damaged rbc were not present in the spleen collected 7 days after phenylhydrazine administration.
    [475] Double labeling experiments were then performed on hydrazine treated rat spleens using ICC and atoptopsis assays with biotin conjugated antibody 205C. Tissues from normal rats and rats treated with phenylhydrazine for 4 days were sectioned to 4 μm thick and air dried in Superfrost Plus (VWR Scientific) at room temperature for 15 minutes and stored at -20 ° C. Before use, the slides were warmed to 50 ° C. Endogenous peroxidase activity was removed by placing warmed sections in a buffer containing 100 mL 1 × TBS, 1.1 mL 30% H 2 O 2 (Sigma), 1 mL 10% NaN 3 (Sigma) at room temperature for 15 minutes. Block each section at 37 ° C. for 10 minutes using 150 μl of a solution containing 20% normal rat serum (Haran Bioproducts) and 2% BSA (Sigma) in 1 × TBS, and then lightly dip the solution from the sections. Removed in a way. Each section was incubated with 75 μl biotinylated hamster anti-rat α d antibody 205C at a protein concentration of 26.6 μg / ml diluted in blocking solution at 37 ° C. for 30 minutes. Thereafter, the sections were washed three times, once for 5 minutes, in 1 × TBS to remove any unbound antibody. Excess TBS was removed by aspirating around the tissues after the final wash. Alkali phosphatase conjugated avidin / biotin complex (Vector Laboratories) prepared according to the manufacturer's instructions was added to each section at 37 ° C. for 20 minutes. After incubation, slides were washed twice with 5 min once in 1 × TBS. Sections were fixed for 5 minutes at 4 ° C. with 4% formaldehyde (Sigma). Sections were then washed in 1 × PBS and placed in CSK buffer (100 mM NaCl, 300 mM sucrose, 10 mM pipes pH 6.8, 3 mM MgCl 2 , 0.5% Triton-X100®) at 4 ° C. for 2 minutes. . Sections were washed in 1 × PBS for 2 minutes at room temperature followed by three sections of 5 minutes once with 1 × PBS. TUNEL reaction mixture (Möllinger Mannheim) was added to each section at 37 ° C. for 60 minutes. After incubation, sections were washed with 1X PBS three times for five minutes each. Apoptosis kit methodology is similar to in situ hybridization; TUNEL reagent (FITC conjugated) hybridizes to "gap" DNA. Converter-POD (peroxidase conjugated antibody that recognizes a FITC tag in TUNEL reagent) was added to each section at 37 ° C. for 30 minutes, and the sections were washed three times, once for 5 minutes with 1 × PBS. AEC (Vector Laboratories) was added and immersed in water to stop color development. Sections were fixed with Aquamount (VWR).
    [476] In the model, a large number of cells in the red and white stromal regions of the spleen have undergone apoptosis, but macrophages in the red stromal uptake that absorbs RBC (expressing α d and not found in the seventh day model) It was not found to progress apoptosis.
    [477] Rat α in normal rat spleen dCell Type Analysis of Expression
    [478] To determine rat cell types expressing α d , double label staining was performed in normal rat spleen. Sections of normal rat spleens were prepared as described above through the rat serum blocking step. After addition of the primary cell marker antibody, the alkaline phosphatase conjugated goat anti-mouse antibody (Jackson Laboratories) was diluted 1: 500 using the same diluent as used for the primary antibody and 30 at room temperature. 75 μl was added to each section for a minute. Sections were washed twice for 5 min once in 1 × TBS. Alkali phosphatase conjugated donkey anti-goat antibody (Jackson Laboratories) was diluted 1: 300 in antibody diluent and 75 μl was added to each section for 30 minutes at room temperature. After washing and blocking as described above, each section received 75 μl of biotinylated hamster anti-rat α d antibody (205C) at a protein concentration of 20 μg / ml for 1 hour 45 minutes, washed and unbound Antibody was removed. Excess TBS was removed by aspirating around the tissues after the final wash. Peroxidase conjugated goat anti-biotin antibody (Vector Laboratories) was diluted 1: 200 in antibody diluent and 75 μl was added to each section for 45 minutes at room temperature. The slides were washed twice with 5 min once in 1 × TBS. AEC substrate (Vector Laboratories) was added and immersed in water to stop color development. Fast blue substrate (Vector Laboratories) was added and immersed in water to stop color development. The sections were then fixed with Aquamount (VWR).
    [479] Dual antibody immune cells using antibodies against CD5, CD2, CD4, CD8, NK markers, or HIS 45 (T cell markers) in combination with anti-α d antibodies in an attempt to determine the phenotype of cells expressing α d Chemistry was carried out. No double labeled cells were detected using CD2 / α d or HIS 45 / α d . Α d labeled clusters of small cells in the splenic red stroma of normal rats were found to express CD5. Whether CD5-positive cells were T cells or B cells was not measured. Small groups of cells expressing a d in the red stroma were measured to express CD4. In addition, subsets of NK cells and CD8 positive cells expressing a d were identified. Thus, α d expression in the spleen was found in a subset of T cells, possibly a subset of B cells, a subset of NK cells and a subset of macrophages.
    [480] Α in giant granulocyte leukocyte (LGL) tumor cells from the F344 rat model dExpression of
    [481] Rat models for LGL-leukemia were designed in F344 rats injected intravenously into three male F344 rats (1 million cells each) using tumor cells obtained from the National Cancer Institute. The disease takes three months to develop symptoms, at which point some animals were killed and tissue examined by FACS and histochemical analysis.
    [482] For FACS analysis, a portion of the spleen was removed and a single cell suspension was prepared as described in the Examples below. In brief, spleen tissue was cut into smaller pieces with scissors and passed through a wire screen in the presence of D-PBS. Cells were pelleted by centrifugation and resuspended in 30 ml D-PBS. A histoplaque gradient (Sigma) was prepared by stratifying 5.0 mL of the cell suspension on 5.0 mL of histoplaque in a 15 mL centrifuge tube. Gradients were centrifuged at 1500 rpm for 30 minutes using a Beckman tabletop centrifugation, cell layers were harvested, washed once in D-PBS and counted with a hematocytometer. Cells were resuspended in FACS (RPMI-1640 / 2% FBS, 0.2% sodium azide) at a density of 1 × 10 6 cells / sample.
    [483] Cells were incubated with two colors with one of a series of antibodies against hamster anti-rat α d antibody 205C conjugated to biotin (10 μg / ml) and FITC conjugated rat cell markers. These second antibodies are anti-macrophage-FITC, anti-CD3-FITC and anti-IgM (B-cell) -FITC antibodies (all from Pharmingen) in addition to FITC-conjugated antibodies (available from Haran) with NK cell specificity Acquisitions). FITC conjugated antibodies were used at 10 μl / sample each.
    [484] Samples were first incubated with 205C-biotin antibody on ice for 30 minutes, washed three times with FACS buffer and resuspended in 1.0 ml FACS buffer. FITC conjugate was added with 5 μl Streptavidin-PE (Pharmingen) and the sample was placed on ice for 30 minutes. After incubation, samples were washed three times with FACS buffer and resuspended in 200 μl FACS buffer. Samples were examined with a Beckton Dickinson FACscan and data analyzed using Lysis II software (Becton Dickinson).
    [485] This result clearly demonstrates that α d is expressed on the surface of NK or LGL cells. Cells stained positive for B-cell and T-cell markers did not show α d expression, and cells stained with macrophage markers showed only slight α d expression. The spleen in the disease at this point is thought to consist mainly of NK tumor cells, which is consistent with the observation that a large group of spleen cells are stained for expression of both NK markers and α d .
    [486] These observations were consistent with those obtained from similar experiments using peripheral blood cells harvested and treated from the same animals as described above for FACS. Results using peripheral blood cells suggest that NK cells in the blood express α d while cells expressing other cellular markers in the blood do not show α d expression. However, the results using peripheral blood cells are not as sharp as those using spleen cells, which is presumed to be due to the difference in the ratio of the different cell types present in the spleen and peripheral blood.
    [487] The same results were obtained in subsequent FACS analysis of rat spleen cells from these model animals. Upon further analysis using the cell preparation method, LGL tumor cells showed staining for the expression of CD18 as well as CD11a, CD11b and CD11c.
    [488] Histochemical analysis was performed on normal tissue and NK F344 diseased tissue using the ICC procedure as described above. Preliminary data show that α d is expressed in NK F344 tumor lung and liver tissue, but not detected or at very low levels in each normal tissue. Diseased lung tissue showed α d expression in individual cells throughout the lung, as well as in large and small clusters of cells. NK F344 liver weakly labeled other cells throughout the tissue and around blood vessels. Antibodies to other β 2 integrins are expressed at similar levels, although these molecules vary in labeling pattern in normal as well as diseased tissues.
    [489] In a similar analysis, the normal rat thymus slightly expressed α d in cells interspersed with the cortex, whereas the F344 NK thymus showed increased levels of α d expression. Normal spleen exhibited expression in red stroma and NK spleen included missing cluster labeling throughout tissue.
    [490] The NK spleen was then tested at weekly intervals after the onset of the disease, with the result that α d expression levels increased by week 3 and dropped at week 4.
    [491] Example 27
    [492] Anti-α dAssay for NK-Tumor Cell-Induced Target Cell Lysis Using Monoclonal Antibodies
    [493] The specific function of NK cells is to target and kill virus infected foreign cells. To assess the ability of NK cells to lyse specific target cells, target cells are labeled with 51 Cr, and if cell lysis occurs, an increase in radioactivity is detected in the medium. Α d, which has already been found to be expressed in NK cells, is assumed to precipitate upon NK targeted cell death. To test this hypothesis, tumor cells were pre-cultured with α d antibodies to assess the role of α d in functional analysis.
    [494] α dPreparation of Positive NK-Tumor Effector Cells
    [495] F344 rats were infused with NK tumor cells originally obtained from the National Cancer Institute and passaged in animals 3-4 weeks before spleen removal. The spleen was removed and cut into small pieces and passed through a wire screen in the presence of D-PBS. The resulting cell suspension was centrifuged for 10 minutes at room temperature with a Beckman tabletop centrifuge. The supernatant was aspirated and the cell pellet was resuspended in 30 ml D-PBS.
    [496] Histoplasmic isolation of monocyte cells taken from blood was performed as follows. 5 ml of histoplaque (Sigma) was added into six 15 ml centrifuge tubes, and 5.0 ml of the cell suspension was layered on top of it. Cells were centrifuged at 1500 rpm for 30 minutes at room temperature using a Beckman tabletop centrifuge. Cell layers were harvested, pooled and counted with a hematocytometer. Dilutions were prepared by diluting the isolated tumor cells several times in D-PBS buffer and incubated with or without anti-rat α d antibodies at a concentration of 50 μg / ml. Control antibodies included anti-rat ICAM-1 and anti-rat CD18 antibodies incubated with cells at a concentration of 50 μg / ml. Tumor cells were preincubated with antibodies at 37 ° C. for about 30 minutes prior to analysis.
    [497] Chromium Labeling of Yak-1 Target Cells
    [498] Yak-1 cells (ATCC), a mouse lymphoma cell line, were cultured in 10% FBS / RPMI 1640. Cells were harvested by centrifugation and resuspended at a density of about 1 × 10 7 cells in 1.5-4.0 ml of RPMI “test medium” prepared from 500 ml RPMI 1640, 5 ml Pen-Strep antibiotic solution and 10 ml FBS. About 200-300 μCi of 51 chromium was added to the Yak-1 cell suspension and incubated at 37 ° C. for 45-60 minutes with gentle mixing. After incubation, the cells were pelleted by increasing the volume to 50 ml using test media and centrifuging. The supernatant was discarded and cells were resuspended in 1-3 ml test medium and adjusted to a density of 5 × 10 4 cells / ml. Unlabeled Yak-1 cells were prepared at a concentration of 1 × 10 7 cells / ml and used as autologous controls.
    [499] The activity of labeled cells was determined by triple analysis of 100 μl labeled cell suspension using a gamma counter.
    [500] Short term chromium emission analysis
    [501] NK effector cells of each dilution were plated in triplicate in a volume of 100 μl of test medium in a 96 well microtiter plate and 100 μl labeled Yak-1 cells were added to each well. 100 μl of labeled cells with unlabeled Yak cells in each effector dilution were incubated to obtain self release, ie spontaneous or background release. In one set of wells 1.0% Triton® was added to the target cells to obtain a total of 51 chromium releases. Spontaneous release was measured by the amount of 51 chromium found in the wells when only target cells were used. Incubation of effector / target cells was performed at 37 ° C. for 4 hours, after which the plates were centrifuged and 100 μl supernatant was collected from each well and radioactivity was measured.
    [502] Cytolytic activity was calculated using the following equation.
    [503] % Cytolytic activity =
    [504] [Cmp-voluntary release cmp / 100% release cmp-voluntary release cmp of the sample] × 100
    [505] These results suggest that hamster anti-rat α d antibodies (including 199M and 205C) and mouse anti-rat α d antibodies (226A, 226B, 226C, 226D, 226F, 226G, 226H, and 226I) are also NK tumors. Cells cannot result in the ability to kill or lyse labeled target cells.
    [506] Example 28
    [507] Isolation of Mouse cDNA Clone
    [508] An isolation of mouse α d homologues was attempted.
    [509] Hybridization hybridization was performed using two PCR generated probes. The two probes are a 1.5 kb fragment corresponding to bases 522-2047 from human clone 19A2 (SEQ ID NO: 1) and a 1.0 kb rat fragment corresponding to bases 1900-2900 of human clone 19A2 (SEQ ID NO: 1). Human probes were formed by PCR using primer pairs designated ATM-2 and 9-10.1 as shown in SEQ ID NOs: 38 and 39, respectively, and rat probes were formed using primer pairs 434L and 434R as shown in SEQ ID NOs: 34 and 35, respectively. It was. Samples were incubated at 94 ° C. for 4 minutes and 94 ° C .; 50 ° C., 2 minutes; 30 cycles of temperature step sequence of 72 degreeC and 4 minutes were performed.
    [510] 5'-GTCCAAGCTGTCATGGGCCAG-3 '(SEQ ID NO: 38)
    [511] 5'-GTCCAGCAGACTGAAGAGCACGG-3 '(SEQ ID NO: 39)
    [512] Purify the PCR product using the Qiagen Quick Spin Kit according to the manufacturer's suggested protocol, and label DNA approximately 180 with 200 μCi [ 32 P] -dCTP using the Boehringer Mannheim random primer labeling kit according to the manufacturer's suggested protocol It was. Unincorporated isotopes were removed using a Sentry-Sep spin column (Princetone Separation, Adelpia, NJ) following the manufacturer's protocol. The probe was denatured with 0.2 N NaOH and neutralized prior to use with 0.4 M Tris-HCl, pH 8.0.
    [513] Mouse thyroid oligo dT-primed cDNA libraries in Lambda ZAP® II (Stratagen) were plated at about 30,000 plaques per 15 cm plate. The plaque lift in a nitrocellulose filter (Schliheer & Schiel, Keene, NH) was incubated at 50 ° C. with stirring for 1 hour in a prehybridized solution containing 8% formamide (8 mL / lift). Labeled human and rat probes were added to the prehybridization solution and incubated overnight at 50 ° C. The filter was washed twice with 2X SSC / 0.1% at room temperature, once with 2X SSC / 0.1% SDS at 37 ° C, and once with 2X SSC / 0.1% SDS at 42 ° C. The filter was exposed on a Kodak X-Omat AR film at −80 ° C. for 27 hours using a strengthening screen.
    [514] Four plaques that gave a positive signal in the replication lift were replated in LB medium using magnesium (LBM) / carbenicillin (100 mg / ml) plates and incubated overnight at 37 ° C. Phage plaques were lifted with a Hybond® filter (Amersham), probed as in the initial screen, and exposed to Kodak X-Omat AR film for 24 hours at -80 ° C using a strengthening screen.
    [515] Twelve plaques that gave a positive signal were delivered in low Mg ++ phage dilutions containing 10 mM Tris-HCl and 1 mM MgCl 2 . Insert size was determined by PCR amplification using T3 and T7 primers (SEQ ID NOs. 13 and 14, respectively) and the following reaction conditions. Samples were incubated at 94 ° C. for 4 minutes and 94 ° C., 15 seconds; 50 ° C., 30 seconds; 30 cycles of temperature step sequence of 72 degreeC and 1 minute were performed.
    [516] Six samples produced separate bands of 300 base to 1 kb in size. Phagemid was released through the co-infection with a helper phage Blue Script (registered trademark) SK - was typed into jaehwan (Strata Zen). The resulting colonies were incubated overnight in LBM / carbenicillin (100 mg / ml). DNA was isolated with Promega Wizard® Miniprep Kit according to the manufacturer's suggested protocol. Eco RI restriction analysis of the purified DNA confirmed the detected molecular weight using PCR. The sequence of the insert DNA was determined with the M13 and M13 reverse 1 primers disclosed in SEQ ID NOs: 40 and 41, respectively.
    [517] 5'-TGTAAAACGACGGCCAGT-3 '(SEQ ID NO: 40)
    [518] 5'-GGAAACAGCTATGACCATG-3 '(SEQ ID NO: 41)
    [519] Sequencing was performed as described in Example 4.
    [520] Of the six clones, only two clones named 10.3-1 and 10.5-2 provided sequence information, the same 600 bp fragment. The 600 bp sequence was 68% identical to the corresponding region of human α d , 40% identical to human CD11a, 58% identical to human CD11c, and 54% identical to mouse CD11b. A more complete cDNA encoding the putative mouse α d homologue was isolated using a 600 bp fragment.
    [521] Mouse spleen cDNA libraries (oligo dT − and random-priming) from Lambda Zap II (Stratagen) were plated with 2.5 × 10 4 phage / 15 cm LBM plates. Plaques were lifted on Hybond® nylon transfer membrane (Amersham), denatured with 0.5 M NaOH / 1.5 M NaCl, neutralized with 0.5 M Tris base / 1.5 M NaCl / 11.6 HCl, and washed with 2 × SSC. DNA irradiation was crosslinked to the filter by ultraviolet irradiation.
    [522] About 500,000 plaques were screened using previously labeled probes 10.3-1 and 10.5-2 as described above. The probe was added to the prehybridization solution and incubated at 50 ° C. overnight. The filter was washed twice with 2X SSC / 0.1% SDS at room temperature, once with 2X SSC / 0.1% SDS at 37 ° C, and once with 2X SSC / 0.1% SDS at 42 ° C. The filter was exposed on a Kodak X-Omat AR film for 24 hours at -80 ° C using a strengthening screen. For 14 plaques giving a positive signal in the replication lift, a final heavy wash of 2X SSC / 0.1% SDS at 50 ° C, 0.5X SSC / 0.1% SDS at 50 ° C and 0.2X SSC / 0.1% SDS at 55 ° C. A secondary screen was carried out in the same manner as the initial screen except that was further performed. The filter was exposed on a Kodak X-Omat AR film for 13 hours at -80 ° C using a strengthening screen.
    [523] Eighteen positive plaques were delivered in low Mg ++ phage dilutions and insert size was determined by PCR amplification as described above. Seven samples provided a single band of 600 bp to 4 kb in size. Eco RI restriction analysis of the purified DNA confirmed the size observed using PCR, and the sequence of the DNA was determined by primers M13 and M13 reverse 1 (SEQ ID NOs 40 and 41, respectively).
    [524] One clone, designated B3800, corresponds to the 200 base region downstream of the 5 'end of the human α d 19A2 clone and comprises a 4 kb insert comprising 553 bases of the 3' untranslated region. Clone B3800 is the same region and 77% of the human α d, and the corresponding region of human CD11a with the same 44%, and the corresponding region of human CD11c, and equal to 59%, which was identical to mouse CD11b in the area and 51%. Second clone A1160 was a 1.2 kb insert aligned at the 5 'end of the human α d coding region downstream of about 12 nucleic acids of the starting methionine. Clone A1160 has corresponding region of human α d and equal to 75%, and the corresponding region of human CD11a with the same 46%, and the corresponding region of human CD11c, and equal to 62%, which was identical to mouse CD11b in the area and 66%.
    [525] Clone A1160, a fragment closer to the 5 'end of human clone 19A2, is 1160 bases long and shares an overlap with clone B3800 starting at base 205 and reaching base 1134. Clone A1160 comprises a 110 base insert (bases 704-814 of clone A1160) that was not present in the overlapping region of clone B3800. This insertion possibly occurs at the exon-intron boundary [Fleming, et al., J. Immunol. 150: 480-490 (1993)] before subsequent ligation of clones A1160 and B3800.
    [526] Estimated mouse α dRapid Amplification of the 5 'cDNA End of the Clone
    [527] RACE PCR [Frohman, "RACE: Rapid Amplification of cDNA Ends," in PCR Protocols: A Guide to Methods and Applications, Innis, et al. (eds.) pp. 28-38, Academic Press: New York (1990)] was used to obtain missing 5 'sequences of putative mouse α d clones, including 5' untranslated sequences and starting methionine. Mouse spleen RACE-Ready kit (Clontech, Palo Alto, Calif.) Was used according to the manufacturer's suggested protocol. Two antisense, gene specific primers, A1160 RACE1-1 order and A1160 RACE2-nested (SEQ ID NOs: 42 and 43) were designed and subjected to primary and nested PCR.
    [528] 5'-GGACATGTTCACTGCCTCTAGG-3 '(SEQ ID NO: 42)
    [529] 5'-GGCGGACAGTCAGACGACTGTCCTG-3 '(SEQ ID NO: 43)
    [530] The primers SEQ ID NOs: 42 and 43 correspond to regions starting at 302 and 247 bases from the 5 'end, respectively. PCR was performed as described above using 5 'anchor primer (SEQ ID NO: 44) and mouse spleen cDNA provided with the kit.
    [531] CTGGTTCGGCCCACCTCTGAAGGTTCCAGAATCGATAG (SEQ ID NO: 44)
    [532] Electrophoresis of the PCR product revealed a band of about 280 bases in size, which was subcloned using a TA cloning kit (Invitrogen) according to the manufacturer's suggested protocol. Ten resulting colonies were incubated, DNA isolated and sequenced. An additional 60 bases of the 5 'sequence were identified by this method, corresponding to bases 1-60 of SEQ ID NO: 45.
    [533] Characterization of Mouse cDNA and Putative Amino Acid Sequences
    [534] The complex sequence of mouse cDNA encoding the putative homologue of human α d is shown in SEQ ID NO: 45. Homology between human external domains and mouse clones is high, but C-terminal homology between cytoplasmic domains is only 30%. Observed modifications may indicate functional differences between human and mouse proteins. Alternatively, the difference in the cytoplasmic domain may be from splice modifications or to indicate the presence of additional β 2 integrin gene (s).
    [535] At the amino acid level, 28% identity to mouse CD11a from mouse cDNA, 53% identity to mouse CD11b, 28% identity to human CD11a, 55% identity to human CD11b, 59% identity to human CD11c And a protein with 70% identity to human α d . Comparing the amino acid sequence of the cytoplasmic domain of human α d with the putative mouse homologue, it is confirmed that the regions are the same in length but different in primary structure. The similar lengths of these regions suggest that the strain shape is longitudinal strain rather than splice strain. In Example 20 above, the cytoplasmic domains of mice and rats have at least 60% identity when compared to putative rat polypeptides.
    [536] Example 29
    [537] Additional Mouse α for Sequence Identification dIsolation of cDNA
    [538] In order to verify the nucleic acid and amino acid sequences disclosed in Example 28 for mouse a d , additional mouse sequences were isolated for identification purposes.
    [539] Mouse cDNA by hybridization with two homologous α d probes (3 ′ and 5 ′), using both oligo dT-priming cDNA library of Lambda ZAP® II (Stratagen) and mouse spleen random priming library Separation was performed. Libraries were plated at 5 × 10 5 phages per 15 cm LBM plate. Plaques were lifted on Hybond® nylon transfer membrane (Amersham), denatured (0.5 M NaOH / 1.5 M NaCl), neutralized (0.5 M Tris base / 1.5 M NaCl / 11.6 HCl) and washed (2 × SSC salt solution). DNA irradiation was crosslinked to the filter by ultraviolet irradiation.
    [540] Probes were formed using the primers described below in the PCR reaction using the following conditions. Samples were held at 94 ° C. for 4 minutes and 30 cycles of temperature step sequence (94 ° C., 15 seconds; 50 ° C., 30 seconds; 72 ° C., 1 minute) in a Perkin-Elmer 9600 thermocycler were performed.
    [541] The 3 'probe is about 900 bases long and spans nucleotides 2752 to 3651 (from 5' → 3 ') (in SEQ ID NO: 1), primers 11b-1 / 2FOR11 and Prepared using 11.b-1 / 2REV2. The probe was used for the first set of lifts.
    [542] The 5 'probe is about 800 bases long and spans nucleotides 149 to 946 (5' → 3 ') (in SEQ ID NO: 1) and primers 11b-1 / 2FOR1 and 1 as shown in SEQ ID NOs: 50 and 85, respectively. Prepared using 11.a-1 / 1REV1. Probes were used for the second set of lifts.
    [543] In the third lift set, two probes as described above were used together in the sample plate.
    [544] About 500,000 plaques were screened using two probes obtained from above labeled in the same manner as described in Example 20. Labeled probes were added to a prehybridized solution containing 45% formamide and incubated overnight at 50 ° C. The filter was washed twice with 2 × SSC / 0.1% SDS at room temperature (22 ° C.). Final washes were performed at 50 ° C. with 2 × SSC / 0.1% SDS. Autoradiography was performed on Kodak X-Omat AR films at −80 ° C. for 19 hours using a strengthening screen.
    [545] For at least 13 plaques that showed a positive signal in the replication lift, initial, except that both 3 'and 5' labeled probes were used for hybridization and additional final washes were performed using 2X SSC / 0.1% SDS at 65 ° C. Secondary screens were performed as described for the screens. As described above, autoradiography was performed for 2.5 hours.
    [546] Thirteen plaques (named MS2P1 to MS2P13) giving a positive signal were delivered in low Mg ++ phage dilutions. Insert size was determined by PCR amplification with T3 and T7 (sequences as described above) annealed to BlueScript® phagemid in ZAP® II under the same conditions as described above. Band size was 500 bases to 4 Kb. Phagemids were isolated, prepared, and sequenced with M13 and M13 reverse 1 primers (SEQ ID NOs: 40 and 41, respectively). Five of the 13 clones, MS2P-3, MS2P-6, MS2P-9, MS2P-12, and MS2P-13, are sequenced together, which together form the first at about 3 'to about 200' base at the 5 'end. A region up to about 300 bases past the stop codon is shown.
    [547] First perform automatic sequencing as in Example 4 using M13 and M13 reverse 1 primers (SEQ ID NOs: 40 and 41, respectively) to sequence the ends of each clone and position for construct 17 (SEQ ID NO: 45) Was determined. Each clone was then sequenced completely using the appropriate primers for the specific region (shown below).
    [548] 11.b-1 / 2FOR1 5'-GCAGCCAGCTTCGGACAGAC-3 '(SEQ ID NO: 50)
    [549] 11.a-1 / 1FOR2 5'-CCGCCTGCCACTGGCGTGTGC-3 '(SEQ ID NO: 60)
    [550] 11.a-1 / 1FOR3 5'-CCCAGATGAAGGACTTCGTCAA-3 '(SEQ ID NO: 61)
    [551] 11.b-1 / 2FOR4 5'-GCTGGGATCATTCGCTATGC-3 '(SEQ ID NO: 62)
    [552] 11.b-1 / 2FOR5 5'-CAATGGATGGACCAGTTCTGG-3 '(SEQ ID NO: 63)
    [553] 11.b-1 / 2FOR6 5'-CAGATCGGCTCCTACTTTGG-3 '(SEQ ID NO: 64)
    [554] 11.b-1 / 2FOR7 5'-CATGGAGCCTCGAGACAGG-3 '(SEQ ID NO: 65)
    [555] 11.b-1 / 2FOR8 5'-CCACTGTCCTCGAAGCTGGAG-3 '(SEQ ID NO: 66)
    [556] 11.b-1 / 2FOR9 5'-CTTCGTCCTGTGCTGGCTGTGGGCTC-3 '(SEQ ID NO: 67)
    [557] 11.b-1 / 2FOR10 5'-CGCCTGGCATGTGAGGCTGAG-3 '(SEQ ID NO: 68)
    [558] 11.b-1 / 2FOR11 5'-CCGTGATCAGTAGGCAGGAAG-3 '(SEQ ID NO: 69)
    [559] 11.b-1 / 2FOR12 5'-GTCACAGAGGGAACCTCC-3 '(SEQ ID NO: 70)
    [560] 11.b-1 / 2FOR13 5'-GCTCCTGAGTGAGGCTGAAATCA-3 '(SEQ ID NO: 71)
    [561] 11.b-1 / 2FOR14 5'-GAGATGCTGGATCTACCATCTGC-3 '(SEQ ID NO: 72)
    [562] 11.b-1 / 2FOR15 5'-CTGAGCTGGGAGATTTTTATGG-3 '(SEQ ID NO: 73)
    [563] 11.b-1 / 2REV2 5'-GTGGATCAGCACTGAAATCTG-3 '(SEQ ID NO: 74)
    [564] 11.b-1 / 2REV3 5'-CGTTTGAAGAAGCCAAGCTTG-3 '(SEQ ID NO: 75)
    [565] 11.b-1 / 2REV4 5'-CACAGCGGAGGTGCAGGCAG-3 '(SEQ ID NO: 76)
    [566] 11.b-1 / 2REV5 5'-CTCACTGCTTGCGCTGGC-3 '(SEQ ID NO: 77)
    [567] 11.b-1 / 2REV6 5'-CGGTAAGATAGCTCTGCTGG-3 '(SEQ ID NO: 78)
    [568] 11.b-1 / 2REV7 5'-GAGCCCACAGCCAGCACAGG-3 '(SEQ ID NO: 79)
    [569] 11.b-1 / 2REV8 5'-GATCCAACGCCAGATCATACC-3 '(SEQ ID NO: 80)
    [570] 11.b-1 / 2REV9 5'-CACGGCCAGGTCCACCAGGC-3 '(SEQ ID NO: 81)
    [571] 11.b-1 / 2REV10 5'-CACGTCCCCTAGCACTGTCAG-3 '(SEQ ID NO: 82)
    [572] 11.b-1 / 2REV11 5'-CCATGTCCACAGAACAGAGAG-3 '(SEQ ID NO: 51)
    [573] 11.b-1 / 2REV12 5'-TTGACGAAGTCCTTCATCTGGG-3 '(SEQ ID NO: 83)
    [574] 11.b-1 / 2REV13 5'-GAACTGCAAGCTGGAGCCCAG-3 '(SEQ ID NO: 84)
    [575] 11.a-1 / 1REV1 5'-CTGGATGCTGCGAAGTGCTAC-3 '(SEQ ID NO: 85)
    [576] 11.a-1 / 1REV2 5'-GCCTTGGAGCTGGACGATGGC-3 '(SEQ ID NO: 86)
    [577] Sequences were edited, aligned and compared to pre-separated mouse α d sequences (Structure 17, SEQ ID NO 45).
    [578] Alignment of the new sequence revealed the 18 base deletion of construct 17 starting at nucleotide 2308. This deletion did not cause leading frame shift. The cloned MS2P-9, sequenced as described above, showed the same 18 base deletions. This deletion was observed to occur in 50% of mouse clones comprising the region, but not in rat or human α d clones. The 18 base deletion is characterized by a 12 base palindromic sequence AAGCAGGAGCTCCTGTGT (SEQ ID NO: 91). The reverse repeat of the nucleic acid sequence is self-complementary and can form a loop out, which causes degradation during reverse transcription. A mouse α d sequence comprising an additional 18 bases is disclosed in SEQ ID NO: 52, and putative amino acid sequence is shown in SEQ ID NO: 53.
    [579] Example 30
    [580] In situ hybridization in mice
    [581] Tissue distribution for mouse α d was measured for comparison with the human case described in Example 6.
    [582] In vitro RNA transcription incorporating 35 S-UTP (Amersham) formed a single-stranded 200 bp mRNA probe from the DNA template corresponding to nucleotides 3460-3707 of the cytoplasmic tail region of murine cDNA.
    [583] Whole mouse embryos (collected 11-18 days after fertilization) and various mouse tissues such as the spleen, kidney, liver, intestine and thymus were in situ hybridized with radiolabeled single-stranded mRNA probes.
    [584] Tissues were sectioned to a thickness of 6 μm, attached to a vector bond (Vector Laboratories Inc., Burlingham, Calif.) Coated slides and stored at -70 ° C. Before use, the slides were removed from −70 ° C. and left at 50 ° C. for about 5 minutes. Sections were fixed in 4% paraformaldehyde at 4 ° C. for 20 minutes, dehydrated at 4 ° C. for 1 minute at each concentration using increasing ethanol gradient (70-95-100%), and air dried at room temperature for 30 minutes. Sections were denatured with 70% formamide / 2X SSC at 70 ° C. for 2 minutes, washed twice with 2X SSC, dehydrated with an ethanol gradient as above and air dried for 30 minutes. 6 to provide a final concentration of 50% formamide, 0.3 M NaCl, 20 mM Tris-HCl, pH 7.5, 10% dextran sulfate, 1 × Denhardt's solution, 100 mM dithiothreitol (DTT) and 5 mM EDTA. in × 10 5 cpm / fragments as 55 ℃ in a solution containing 35 S- labeled ribonucleotide probe and fatigue diethyl carbonate (DEPC) treated water was carried out overnight (12-16 hours) hybridization. After hybridization, section into 4X SSC / 10 mM DTT for 1 hour at room temperature, 50% formamide / 2X SSC / 10 mM DTT for 40 minutes at 60 ° C., 2X SSC for 30 minutes at room temperature, and 0.1X SSC for 30 minutes at room temperature. Washed. Sections were dehydrated, air dried for 2 hours, coated with Kodak NTB2 photograph emulsion, air dried for 2 hours, developed (after storage at 4 ° C. in complete dark) and counterstained with hematoxylin / eosin It was.
    [585] The spleen tissue showed a strong signal mainly in the red pulp. This pattern matches the pattern of tissue macrophage distribution in the spleen, but differs from other cell types.
    [586] Example 31
    [587] Formation of Mouse Expression Constructs
    [588] Inserts from clones A1160 and B3800 were ligated to construct expression plasmids containing mouse cDNA sequences showing homology to human α d . However, prior to ligation, a 5 'leader sequence comprising starting methionine was added to clone A1160. Primers named "5 'PCR reader" (SEQ ID NO: 47) include (1) the same nonspecific base at positions 1-6 for degradation; (2) a Bam HI site at positions 7-12 to facilitate subcloning into the expression vector (underlined in SEQ ID NO: 47); (3) the common cossack sequence at positions 13-18, (4) the signal sequence comprising the codon for the initiating methionine (bold in SEQ ID NO: 47), and (5) specificity from clone A1160 to enable primer annealing It was designed to contain an additional 31 bases of the 5 'sequence that would be redundant. A second primer named "3 'terminal flag" (SEQ ID NO: 48) was used with the primer "5' PCR reader" to amplify the insert from clone A1160.
    [589] 5-AGTTAC GGATCC GGCACC ATG AC-
    [590] -CTTCGGCACTGTGATCCTCCTGTGTG-3 '(SEQ ID NO 47)
    [591] 5'-GCTGGACGATGGCATCCAC-3 '(SEQ ID NO 48)
    [592] The resulting PCR product is not degraded to Bam HI, which means that an insufficient number of bases precede the restriction site, making the enzyme unrecognizable. The length of the "tail" sequence before the Bam HI site of the 5 'primer (SEQ ID NO: 47) was increased and PCR was repeated for the amplification product from the first PCR. 5 'primer named mAD.5'.2 (SEQ ID NO: 49) with an additional 20 base that specifically overlaps with the additional nonspecific base at positions 1-4 and the "5' PCR leader" primer sequence previously used Devised.
    [593] 5'-GTAGAGTTAC GGATCC GGCACCAT-3 ' ( SEQ ID NO: 49)
    [594] Primers "mAD.5'.2" and "3 'terminal flag" were used in the PCR with the first amplification product as template. The resulting secondary PCR product was subcloned into plasmid pCRtmII (Invitrogen) according to the manufacturer's suggested protocol and transformed one shot cell (Invitrogen). Restriction enzyme analysis using Bam HI and Eco RI identified and cloned one clone containing the PCR product. After confirming the sequence, the insert was isolated and gel purified by Bam HI and Eco RI digestion.
    [595] The insert was isolated from clone B3800 by digestion with Eco RI and Not I, gel purified, and added to the ligation reaction containing the increased A1160 Bam HI / Eco RI fragment. Ligation was carried out at 14 ° C. for 14 hours. Vector pcDNA.3 (Invitrogen) digested with Bam HI and Not I was added to the ligation reaction with additional ligase and reacted for another 12 hours. Competent E. coli cells were transformed into aliquots of the reaction mixture, the resulting colonies were cultured, and one with primers 11.b-1 / 2FOR1 and 11.b-1 / 2REV11 (SEQ ID NOs 50 and 51, respectively) Positive clones were identified. The primer is bridged to the A1160 fragment and the B3800 fragment, so detection of the amplification product is to suggest that the two fragments are ligated. The sequence of the positive clone was confirmed by the primers set forth in SEQ ID NOs: 50 and 51, and base 100-1405 was amplified after initiation methionine.
    [596] Example 32
    [597] Knockout Mouse Construction
    [598] To more accurately assess the immunological role of the protein encoded by putative mouse α d cDNA, a “knockout” mouse is devised in which genomic DNA sequences encoding putative α d homologues are disrupted by homologous recombination. The importance of the protein encoded by the broken gene is assessed by the absence of the encoded protein. For the formation of “knockout” mice, see Deng, et al., Mol. Cell. Biol. 13: 2134-2140 (1993).
    [599] Such mice are designed as constructs of plasmids containing sequences that are "knocked out" by homologous recombination events. Mouse genome sequences encoding putative mouse α d homologues were identified from the λFIXII genomic library using 750 base pair fragments of mouse cDNA (corresponding to nucleotides 1985 to 2733 of SEQ ID NO: 45). The primary screening resulted in 14 positive plaques, of which seven were identified by secondary screening. Liquid lysates were obtained from two plaques of the plaques giving the strongest signal and lambda DNA was obtained by conventional methods. Restriction mapping and Southern blot analysis confirmed the positiveness of one clone named 14-1, and insert DNA was isolated by Not I digestion. Fragments were cloned with BlueScript® SKII + .
    [600] Southern hybridizations were performed with 750 bp cDNA probes to identify restriction fragments of about 9-14 kb in length, reported to optimize the likelihood of homologous recombination events. Prior to hybridization, restriction maps were generated for clone 14-1. 12 kb fragments were identified as possible candidates, which were subcloned into pBluescript® SKII + at the position where the mouse DNA was adjacent to the thymidine kinase coding cassette. Further analysis of the clones using an I domain probe (corresponding to nucleotides 454-1064 of SEQ ID NO: 45) shows that the clone does not contain a sequence encoding the I domain.
    [601] The λFIXII genomic library was rescreened using the same I domain probe. Initially six positive clones were detected, one of which was positive at secondary screening. DNA isolated from this clone reacted strongly with the I domain probe in Southern analysis. However, no reactivity was detected using the original 750 bp probe, suggesting that this clone contains region 5 'for nucleotides 1985-2773 of SEQ ID NO: 45.
    [602] Alternatively, the lack of hybridization for the 750 bp probe suggests that the clone is another member of the protein's integrin. To determine if this explanation is valid, the 13 kb insert was subcloned into pBlueScript® SKII + . The primers corresponding to the α d I domain nucleic acid sequences 441-461, 591-612, 717-739 of SEQ ID NO: 52 and reverse 898-918 primers were used to determine the sequence of purified DNA. Sequence information was obtained using only the first 4441-4461 primers, and only the 5′-outside exon of the I domain was effectively amplified. The rest of the I domain was not amplified. Thus, the resulting clones included exon 6 of the mouse α d gene and intron sequences for the 3 'and 5' ends of the exon. Exon 7 did not appear in the clones. After sequencing, a construct was formed comprising the neomycin resistance and thymidine kinase genes.
    [603] Neomycin resistance (neo ') gene is inserted into the production plasmid in a manner that blocks the protein coding sequence of genomic mouse DNA. Thus, the resulting plasmids contain the neo 'gene in the mouse genomic DNA sequence, all of which are located in the thymidine kinase coding region. Plasmid construction in this manner is required for homologous recombination rather than random recombination (Chisaka, et al., Nature 355: 516-520 (1992)).
    [604] Alternatives can be used to form constructs useful for the preparation of α d knockout mice. Two sets of oligonucleotide primers were submitted to Genome Systems Inc., St. Louis, Missouri, for high stringency PCR analysis of large insert libraries made from genomic DNA of embryonic hepatocytes. The primers correspond to the first and last exons of the I domain of α d . Three clones were identified, two of which were designated 1117 and 1118, which were reactive with both primers, and one, named 1119, could only amplify primers from the last exon.
    [605] Mouse genome α dIdentification of DNA
    [606] Plasmid DNA was prepared from bacterial lysates of clones 1117 and 1118 according to the manufacturer's instructions (Genome Systems, Inc.). Α d inserts were identified by PCR using oligonucleotides madk.f1 (SEQ ID NO: 104) and madk.r1 (SEQ ID NO: 105) and madk.r2 (SEQ ID NO: 106).
    [607] madk.f1 TGTCCAGGACAAGAGATGGACATTGC SEQ ID NO: 104
    [608] madk.r1 GAGCTATTTCATAGCAAGAATGGG SEQ ID NO: 105
    [609] madk.r2 TATAGCATAGCGAATGATCC SEQ ID NO: 106
    [610] Portions of both plasmids were digested with restriction enzymes Bam HI, Pst I, Sac I, Sal I, Sma I, Xba I, and Xho I (Boehringer Mannheim). Each digested sample was separated on a 0.8% agarose gel and the polynucleotides were transferred to Hybond®-N + nucleic acid transfer membrane (Amersham) for analysis. Oligos were blotted with 32 P-random primed DNA formed using a 1.6 kb template obtained by PCR using madfor 1 (SEQ ID NO: 107) and madrev 1 (SEQ ID NO: 108).
    [611] madfor 1 ATGGTCCGTGGAGTTGTGATC SEQ ID NO: 107
    [612] madrev 1 TCGAGATCCACCAAACTGCAC SEQ ID NO: 108
    [613] Hybridization was performed overnight at 42 ° C. in SSPE buffer containing 50% formamide. The labeled blots were washed five times with 2 × SSPE at room temperature. The radiolabeled bands were visualized by exposing the blots to Kodak X-Omat autoradiography film at -70 ° C. for 2 hours.
    [614] Two fragments of interest from clone 1118 were identified: Sac I fragment of 4.1 kb and Xba I of 8.3 kb. The entire sample contents obtained from Sac I and Xba I digestion of clone 1118 were ligated to pBlueScriptR KS + without further purification, and after ligation the calcium-competent preparation of E. coli strain TG1 / lambda SmR was used as the total reaction contents. Transformed. The resulting colonies were isolated and cultured overnight in 200 μl selection medium containing M13KO7 helper virus to replicate single stranded DNA. 10 μl of supernatant aliquots from each well were blotted onto Hybond®-N + delivery membranes and hybridized using probes and protocols as described above. Cultures from nine positive clones were grown and plasmid DNA was isolated from each culture using Wizard® plus Miniprep DNA Purification System (Promega). Restriction digestion and PCR were used to confirm the presence and size of the inserts in the isolated plasmids.
    [615] Three clones were sequenced using oligonucleotide primers corresponding to the murine α d sequence and vector primers T3 and T7. Sequence comparison of these three clones with murine cDNA using GenWork software revealed that all three clones contained exons 1 and 2 of murine d . The longest clone referred to as A is an 8280 kb long Xba I clone and the two shorter clones called E and H were identical Sac I clones 4112 kb long. An 8280 kb Xba I clone was selected for further progress.
    [616] Example 33
    [617] Rabbit α dCloning
    [618] Construction and Screening of Rabbit cDNA Libraries
    [619] Human α d homology was identified in rats and mice to study the presence of rabbit homologues useful in rabbit models of the human disease states described below.
    [620] Poly A + RNA was prepared from whole rabbit spleens using the Invitrogen FastTrack Kit (San Diego, Calif., USA) and the reagents provided with the kit according to the manufacturer's suggested protocol. From 1.65 g of tissue, 73 μg poly A + RNA was isolated. Rabbit spleen RNA was used to construct a ZAP® cDNA library using a kit from Stratagen (Lazola, Calif.). The cDNA generated into the Eco RI and Xho I sites was cloned in the lambda cancer of the pBK-CMV phagemid vector. Lambda arms were packaged into phage particles using Gigapack® II Gold (Stratagen). The resulting library titer is estimated to be about 8 × 10 5 particles, with an average insert size of 1.2 kb.
    [621] Plaques were grown to plate growth and plated to amplify the library and cell lysates were harvested. E. coli was used to plate the amplified library at about 30,000 plaque forming units (pfu) per 150 mm plate and the resulting mixture was incubated at 37 ° C. for 12-16 hours to form plaques. Phage DNA was transferred to Hybond®-N + nylon membrane (Amersham, Arrington Heights, Ill.). The membrane was hybridized with a mixture of two random priming radiolabeled mouse α d PCR DNA probes. A first probe was formed from a PCR product spanning nucleotides 149-946 of SEQ ID NO: 52. A second probe was obtained from a PCR product spanning nucleotides 2752-3651 of SEQ ID NO: 52. Probes were labeled with random priming (Möllinger Mannheim Random Prime DNA Labeling Kit) and the reaction mixture was passed through a Sephadex® G-50 column to remove unincorporated nucleotides. The hybridization solution consisted of 5X SSPE, 5X Denhardt, 1% SDS, 40% formamide and 1 x 10 6 dpm / ml labeled probe. Hybridization was carried out at 42 ° C. for 16 to 18 hours. The filter was thoroughly washed with 2X SSPE / 0.1% SDS at room temperature and exposed to X-ray film to visualize any hybridization plaques.
    [622] Two clones with significant sequence homology to human α d were identified. Clone # 2 was about 800 bp in length and mapped to the 5 ′ end of human α d . Clone # 2 included the starting methionine and the complete leader sequence. Clone # 7 is about 1.5 kb and contained the starting methionine. The 5 'end of clone # 7 overlaps clone # 2, while the 3' sequence terminates at a point past the I domain sequence. Clone # 7 was fully sequenced by primer walking. The nucleotide and putative amino acid sequences for clone # 7 are shown in SEQ ID NOs: 100 and 101, respectively.
    [623] Estimate for rabbit α d as determined from clones # 2 and # 7 N-terminal amino acid sequence of the human α d, and 73% identity, and mouse α d, and 65% identity, and mouse CD11b, human CD11b, and human CD11c, and 58% It is suggested that the protein has identity. The nucleic acid sequence for clone # 2 is shown in SEQ ID NO: 92 and the putative amino acid sequence is shown in SEQ ID NO: 93.
    [624] Labeled rabbit cron # 7 was used to rescreen the fragment-derived cDNA library to isolate full-length rabbit α d cDNA. Twenty four additional clones were identified and named clone 49 was determined to be the largest. Clone 49 was fully sequenced using the nested deletion technique. The nucleotide and amino acid sequences for clone 49 are shown in SEQ ID NOs: 102 and 103, respectively. Since clones # 7 and # 49 do not overlap, oligonucleotides were designed to be used as primers in PCR with rabbit spleen cDNA of the first strand to isolate missing sequences.
    [625] The relationship between these two partial clones and putative amino acid sequences of other leucointegrins is shown in Table 1.
    [626] % Identity of β 2 integrins and members at the amino acid level Human α d Bunny # 7 Rabbit # 49 Human α d 100 74 80 Mouse α d 70 67 74 Rat α d 70 66 73 Mouse CD11a Random * 28 28 Mouse CD11b 55 59 53 Human CD11a 36 28 28 Human CD11b 60 58 55 Human CD11c 66 59 62 * <25% identity, random sort and not significant.
    [627] Isolation of rabbit α d clones allows expression of the protein on the transformant surface or in soluble full-length or truncated form. This protein is then used as an immunogen for the preparation of monoclonal antibodies for use in rabbit models of human disease states.
    [628] Example 34
    [629] Monkey α dSeparation of
    [630] Preparation of Affinity Columns
    [631] In order to prepare an affinity column to separate α d from monkey spleens, 10 mg of anti-human α d antibodies 212D and 217, respectively, were used overnight in a coupling buffer containing 0.1 M NaHCO 3 , 0.5 M NaCl, pH 8.3. Dialysis. About 1.0 g CNBr-Sepharose® 4B (Pharmacia, Pittscataway, JU) was prepared according to the manufacturer's recommended protocol, and 1.0 ml of resin was mixed with each of the dialyzed antibodies. The resulting slurry was spun overnight at 4 ° C. and mixed and centrifuged at 1000 rpm for 5 minutes in a Beckman tabletop centrifuge to obtain a coupled resin. Unabsorbed supernatant aliquots were harvested and analyzed for the presence of uncoupled protein by spectrometer. The results suggest that all available antibodies bind to the gel matrix. The unbound activator on the resin was blocked with 1M ethanol for 2 hours at room temperature, the resin was washed with alternating high and low pH with coupling buffer and washed with 0.1 M NaC 2 H 3 0 2 3H 2 O and 0.5 Final washes were performed using acetate buffer containing M NaCl, pH 4.0. Both resins were stored at 4 ° C. in coupling buffer.
    [632] Manufacture of Monkey Spleen
    [633] Female macaques were obtained from the University of Washington Regional Primate Center. Spleen tissue was injected with 100 U / ml collagenase D (Sigma) and sliced into small pieces. The tissue pieces are then suspended in a small amount of lysis buffer containing 1.0% Triton-X100® detergent and 50 mM Tris, 150 mM NaCl, 2 mM CaCl 2 , 2 mM MgCl 2 , pH 8.0 and stored at -70 ° C. It was. Protease inhibitor PLA (a mixture of pepstatin A, leucopeptin and aprotinin, respectively obtained from Sigma) and 4- (2-aminoethyl) benzene sulfonyl fluoride-HCl (AEBSF) (Nova, La Jolla, CA, USA Biochem) was added to prevent proteolysis during storage. Tissue was stored until a total of six macaque spleens were obtained.
    [634] Spleen tissue from six monkeys was pooled and 10 seconds each in TSA lysis buffer containing 25 mM Tris, 0.15 M NaCl, 0.02% NaN 3 , 1.0% Triton®, 1X PLA and 0.1 mM AEBSF in a Waring blender. Homogenized in 3 cycles. The lysate was collected and placed on a shaking platform at 4 ° C. for 1 hour and then centrifuged at 3000 rpm for 15 minutes in a Beckman tabletop centrifuge. Supernatants were harvested and pelleted cell debris discarded. A total of 550 ml of lysate was collected and pre-cleaned by incubation at 4 ° C. for 2 hours with CNBr Sepharose® pretreated in 1M ethanolamine. After incubation, the resin was removed by centrifugation and the supernatant was collected.
    [635] Affinity Purification and Sequencing
    [636] Spleen lysates prepared as described above were divided in half and mixed with 212D- and 217L-prepared CNBr Sepharose® gels, respectively. After the resulting slurry was mixed while rotating at 4 ° C. for 3 days, the non-absorbed portion was collected by centrifugation at 1500 rpm for 10 minutes in a Beckman tabletop centrifuge and stored. The gel was transferred to a 15 ml centrifuge tube and washed sequentially in several volumes of D-PBS. About 100 μl of each gel aliquot was a reducing sample containing 0.1 M Tris-HCl, pH 6.8, 2.0% SDS, 20% glycerol, 0.0002% bromophenol blue, 10% β-mercaptoethanol (5% final concentration). Boil briefly in buffer, load using 6.0% polyacrylamide SDS gel (SDS-PAGE) and isolate protein. The gel was Cosami stained and proteins with molecular weights consistent with α d and CD18 were detected along with a number of background proteins.
    [637] To improve purification of proteins with molecular weights similar to α d , the bound protein and two 100 μl aliquots of each gel were washed by different means. In one method, the gel is washed several times with a buffer containing 150 mM NaCl, 10 mM Tris, 1.0% Triton-X100®, pH 8.0, and in the second method the gel is washed the same but the bound protein is Eluted in a final wash with 0.05 M glycine, pH 2.4. As described above, the eluted protein was briefly boiled in reducing sample buffer and separated on a 6.0% SDS-PAGE gel. Cosami staining detected any protein consistent with α d and CD18 from the resin washed in low pH glycine buffer, and thus this separation method was chosen. To isolate the protein for sequencing, the remaining CNBr Sepharose® resin was washed four times as described above, and about 3/4 of the resin was suspended in 2.0 ml 0.05 M glycine, pH 2.4 and vortexed vigorously. I was. The resin was pelleted by centrifugation for 3 minutes and the nonabsorbed fractions were collected. The gel was then washed once more with glycine buffer and this wash was collected with the nonabsorbed fractions described above. Two changes were dialyzed for the collected fractions for D-PBS overnight at 4 ° C. After dialysis, the sample was dried to reduce the volume to 1.0 ml.
    [638] For sequencing, the lysates were separated on a 7.0% separation gel and the proteins were transferred to Immobilon (PVDF) membranes (Millipore, Bedpor, Mass.) As described in Example 2. Briefly, the gel was washed once with deionized water and allowed to equilibrate for 15-45 minutes in 10 mM cyclohexylamino-propanesulfonic acid buffer (CAPS), pH10.5, containing 10% methanol. PVDF membranes were washed with methanol and distilled water and equilibrated in CAPS delivery buffer for 15-30 minutes. Proteins were transferred to PVDF membrane at 70 volts for 3 hours and then stained with 0.1% R250 Cosami stain, filtered for 10 minutes. The membrane was washed three times for 10 minutes at 50% methanol / 10% acetic acid at once to remove staining, washed once more in filtered water and dried.
    [639] Two major protein bands of about 150 kD and 95 kD were detected from the 212D- and 217L-coupled resins, which were consistent with the proteins detected in the analytical scale gel run earlier. Less pronounced bands were observed in membranes derived from 217L-coupled resins located just below the 150 kD protein, but were not detected after the membrane was dried. 150 kD bands obtained from each membrane were excised from the membrane and sequenced directly with Applied Biosystems (Foster City, Calif.) Model 473A Protein Sequence Analyzer according to the manufacturer's suggested method.
    [640] As a result, the amino terminal sequence of the monkey protein isolated using 212D-coupled resin has the amino acid sequence set forth in SEQ ID NO: 109, and the amino terminal sequence of the protein isolated using 217L-coupled resin is SEQ ID NO: It can be seen that it has the amino acid sequence disclosed in 110. "X" in SEQ ID NO: 110 indicates a residue that cannot be identified.
    [641] 212D-coupled proteinNLDVEEPTIFQEDASEQ ID NO: 109
    [642] 217L-coupled protein NLDVEEPTIFXEDA SEQ ID NO: 110
    [643] Table 2 shows a comparison of the amino terminal sequences of the different α chains with the human α d and β 2 integrins and the monkey sequences.
    [644] Comparison of Human β 2 α Subunits with Monkey α d Amino Terminal Sequences protein Sequence number Amino terminal sequence Monkey α d 111 F N L D V E E P T I F Q E D A Human α d 112 F N L D V E E P T I F Q E D A G G Human CD11c 113 F N L D T E E L T A F V D S A G Human CD11b 114 F N L D T E N A M T F Q E N A R G
    [645] Based on sequence identity, it can be concluded that 212D and 217L both recognize α d in macaques and humans.
    [646] Example 35
    [647] Characterization of 217L Antigen
    [648] Based on the N-terminal sequence of the protein precipitated from the monkey spleen in the previous examples, it can be concluded that antibodies 217L and 212D recognize α d proteins in both monkeys and humans. However, immunocytochemical (ICC) analysis and immunoprecipitation test results suggest that 217L contains additional reactivity that is not shared with 212D. FACS and ICC experiments with antibodies to all α chains exclude the cross-reactivity of the most closely related leucointegrin α chains CD11c and CD11b with 217L. Thus, the 217 antibody can recognize a novel α-chain that share the structure, glycosylation or splice variants, or, or α d and α d sequence homology.
    [649] The inherent distribution of antigens recognized by antibody 217L in sarcoid lung tissue, showing non-overlapping staining patterns for CD11c (see Example 18), suggests that antigens may have biological significance. Therefore, in order to fully understand the importance of the 217L antigen, basic DNA analysis which encodes a protein and a protein is required, and various methods are considered.
    [650] Immunoprecipitation of the protein complex obtained from human dendritic cells or peripheral blood is carried out using the 217L antibody and the N-terminal sequence of the precipitated protein in turn. Sequence analysis will reveal whether proteins recognized on peripheral blood cells share amino terminal identity with α d . The protein precipitated from dendritic cells or peripheral blood cells is then treated with a deglycosylation enzyme and the molecular weight of the primary amino acid sequence compared to α d and CD11c precipitated from other sources.
    [651] In addition, cDNA libraries formed from dendritic cell RNA are probed with total α d cDNA under low stringency conditions. Reactive clones were analyzed by nucleic acid sequencing over the full length of the clones to determine if a non-α d sequence was present in the clone.
    [652] Example 36
    [653] α dAnimal Models for Determining Therapeutic Usefulness
    [654] Dogs revealed that the immune histology data from the in situ hybridization of rat and mouse spleen macrophages present in red medulla and lymph node expressed mainly the α and d, α d is found in jilkkeun and copper (sinuses). The expression pattern is very similar to that reported for the two murine antigens identified by the monoclonal antibodies F4 / 80 and SK39. The biochemical properties of these murine antigens demonstrate that these antigens differ from α d , and α d is very likely to define the same macrophage subset as the murine F4 / 80 and SK39 antigens.
    [655] In mice, SK39-positive macrophages have been identified in the splenic red stroma and in the lymph nodes, where macrophages can precipitate upon removal of foreign material from the circulation [Jutila, et al., J. Leukocyte Biol. 54: 30-39 (1993). SK39-positive macrophages have also been reported at sites of acute and chronic inflammation. In addition, monocytes gathered into the abdominal cavity inflamed by thioglycolate also express the SK39 antigen. Overall, these findings suggest that if SK39 + cells are α d + , these cells are involved in the removal of foreign material from the spleen and precipitate in inflammation where macrophages play an important role.
    [656] While the function of α d is unclear, other characterized β 2 integrins have been found to be involved in various adhesion events that promote cell migration, improve phagocytosis, and promote cell-cell interactions, all of which are Upregulates the inflammatory process. Thus, it is reasonable to note that inhibiting normal α d function can inhibit inflammation in which macrophages play an important role. This inflammatory action may include i) blocking macrophages that gather at the site of inflammation, ii) preventing macrophage activation at the site of inflammation, or iii) macrophages damaging normal host tissue through specific autoimmune responses or as a result of bystander cell damage. It can be obtained by inhibiting the effector function.
    [657] Examples of disease states that have evidence that macrophages play an important role in the disease process include multiple sclerosis, arthritis, graft atherosclerosis, and some forms of diabetes and inflammatory bowel disease. The animal models described below have been found to reproduce most of these aspects of human disease. Inhibitors of α d function are tested in these model systems to determine if there is a possibility of treating a corresponding human disease.
    [658] Graft atherosclerosis
    [659] Heart transplantation is a currently accepted method of treating some types of terminal heart disease. Since the use of cyclosporin A can increase one-year survival by 80%, the development of advanced graft atherosclerosis has emerged as the leading cause of death for cardiac transplant patients who have survived the first year or more. Recent studies have shown that the incidence of significant graft atherosclerosis after 36 years of heart transplantation is 36-44% [Adams et al., Transplantation 53: 1115-1119 (1992); Adams et al., Transplantation 56: 794-799 (1993).
    [660] Graft atherosclerosis generally affects the entire coronary vessels and consists of diffuse, obstructive endovascular lesions, often accompanied by lipid deposition. The etiology of graft atherosclerosis is not yet known, but is probably associated with differences in histocompatibility between donor and recipient, which is a natural immune response. To date, studies have shown that the area of endometrial hypertrophy consists mainly of macrophages, but often T cells are observed. Thus, macrophages expressing a d may play an important role in the induction and / or onset of graft atherosclerosis. In this case, α d (for example, soluble ICAM-R) are small molecule inhibitors of the monoclonal antibodies or α d function monoclonal of the may be administered as a precaution to receive a heart transplant objects and transplant arteriosclerosis objects in the risk of developing .
    [661] Atherosclerosis in heart transplant patients is a life-threatening risk factor, and graft atherosclerosis is also observed in kidneys and livers, as well as other solid organ implants. The use of α d blockers for treatment can prevent graft atherosclerosis in other organ implants and reduce complications arising from graft failure.
    [662] One model of rat transplanted atherosclerosis includes heterologous cardiac tag plants transplanted through minor histocompatibility barriers. When Lewis heart tagis were transplanted to MHC class I and II-compliant F-344 recipients, 80% of the tagis survived more than three weeks, while 25% of the implants survived indefinitely. Atherosclerotic lesions are formed in the donor's heart during this low degree of transplant rejection. Arterial lesions in tag plants older than 120 days generally show diffuse fibrous endometrial thickening that is indistinguishable from that seen in graft atherosclerosis observed in human cardiac tagograft rejection.
    [663] Rats were implanted with a mismatched heart in a sub histocompatibility antigen, for example Lewis became F-344. Monoclonal antibodies specific for rat α d or small molecule inhibitors of α d were periodically administered to the implant receptor. Such treatment is expected to reduce the incidence of graft atherosclerosis in non-rejected donor hearts. Treatment of rats with α d monoclonal antibodies or small molecule inhibitors may not be limited to prophylactic treatment. Blocking the α d function is expected to reduce macrophage mediated inflammation to restore arterial damage in the implant.
    [664] Atherosclerosis in a Cholesterol Dieted Rabbit
    [665] Rabbits with an arteriosclerosis-induced diet containing cholesterol supplements develop endometrial lesions over most of the lumen surface of the ascending aorta [Rosenfeld et al., Arteriosclerosis 7: 9-23 (1987); Rosenfeld et al., Arteriosclerosis 7: 24-34 (1987). Atherosclerosis lesions observed in these rabbits are similar to those observed in humans. The lesions contain a significant number of T cells, most of which express CD45RO, a marker associated with memory T cells. Almost half of invasive T cells also express MHC class II antigens, and some express IL-2 receptors, suggesting that the majority of the cells are in an activated state.
    [666] One characteristic of atherosclerosis lesions observed in cholesterol-rich rabbits is that there is no apparent presence in rodent models, with the accumulation of many foam cell lesions. Foam macrophages are thought to be formed by uptake of low density lipoproteins (LDL) oxidized by specific receptors. Oxidized LDL particles have been found to be toxic to some cell types, including endothelial cells and smooth muscle cells. Uptake of oxidized LDL particles with potential for toxicity by macrophages contributes to inflammation associated with atherosclerosis lesions by acting as a stimulant to induce macrophage activation.
    [667] Once monoclonal antibodies against rabbit α d are produced, cholesterol diet rabbits are treated. Treatment includes prophylactic administration of α d monoclonal antibodies or small molecule inhibitors to demonstrate that α d + macrophages are involved in the disease process. Further experiments demonstrated that monoclonal antibodies or small molecule inhibitors to α d can restore the vascular damage identified in rabbits with an atherosclerotic diet.
    [668] Insulin-dependent diabetes
    [669] BB rats spontaneously develop insulin dependent diabetes at 70-150 days of age. Immunohistochemical analysis can be used to detect MHC class II + , ED1 + macrophages infiltrating islets of Langerhans early in the disease. Many macrophages are thought to be involved in cell debris and phagocytosis of normal cells. As the disease progresses, a large number of macrophages have been observed to infiltrate the Isle of Langerhans, with a significant number of T cells, later B cells, also appearing to gather at this site (Hanenberg et al., Diabetologia 32: 126: 134 (1989)).
    [670] Diabetes development in BB rats appears to be dependent on early macrophage infiltration and subsequent T cell recruitment. Treatment of BB rats with silica particles toxic to macrophages was effective in blocking early macrophage infiltration in the island of Langerhans. In the absence of early macrophage infiltration, subsequent tissue damage by self-aggressive lymphocyte populations does not occur. Administering monoclonal antibody OX-19 (specific to rat CD5) or monoclonal antibody OX-8 (specific to rat CD8) that blocks T cell related stages of the disease also inhibits the development of diabetes. effective.
    [671] Macrophages play a central role in the onset in this model, making them attractive for testing inhibitors of α d function. Rats with genetic predisposition to the development of insulin dependent diabetes are treated for the development of dysentery by treatment with monoclonal antibodies or small molecule inhibitors to α d . Prevention or delay of onset of onset is evidence that α d plays an important role in macrophage damage to islet cells.
    [672] Inflammatory Bowel Disease (Crohn's Disease, Ulcerative Colitis)
    [673] Animal models used in the study of inflammatory bowel disease (BID) are generally caused by rectal administration of nontoxic stimulants (eg acetic acid or trinitrobenzene sulfonic acid / ethanol). Colorectal inflammation caused by such agents is the result of chemical or metabolic damage, with no chronic and spontaneous recurrence of inflammation associated with human IBD. However, recently introduced models of plasma-injected purified peptidoglycan polysaccharides (PG-PS) from Group A or Group D streptococci have been shown to be more physiologically relevant models for human IBD [Yamada] Et al., Gastroenterology 104: 759-771 (1993).
    [674] In this model, PG-PS is injected into the subtidal tissue layer of the peripheral colon. The formed inflammatory response shows an early acute episode three days after injection, followed by a dual pattern of spontaneous chronic phase after three to four weeks. Late reactions are essentially granulomas, with thickening of the colon, adhesions, sintering and mucous lesions of the colon. In addition to mucosal damage, PG-PS colitis often causes arthritis anemia and granulomatous hepatitis. The intestinal signs of these diseases make it a more attractive model for studying Crohn's colitis because many patients with active Crohn's disease suffer from joint disease and hepatobiliary inflammation.
    [675] Granulomatous lesions are the result of chronic inflammation leading to the recruitment and subsequent activation of monocyte / macrophage lineage. The presence of Crohn's disease and granulomatous lesions in the animal model and the animal model make it an attractive clinical target for α d monoclonal antibodies or other inhibitors of α d function. Inhibitors of α d function are expected to block the formation of lesions associated with IBD or even restore tissue damage observed in this disease.
    [676] arthritis
    [677] Arthritis appears to be a multifactorial disease involving various inflammatory cell types, including neutrophils, T lymphocytes, and phagocytic macrophages. Although various arthritis models exist, preparations of Streptococcus cell wall proteoglycans cause diseases most similar to human diseases.
    [678] In rats, the Streptococcus cell wall induces inflammation of peripheral joints, which is alleviated after repeated occurrences of disease progression and finally causes joint destruction for several months [Cormartie et al., J. Exp. Med. 146: 1585-1602 (1977); Schwab et al., Infection and Immunity 59: 4436-4442 (1991). In the chronic stage of the disease, mononuclear phagocytes or macrophages are thought to play an important role in the destruction of synovial fluid. In addition, agents that inhibit the recruitment of macrophages to the synovial fluid effectively reduce the inflammation and etiology characteristic of arthritis.
    [679] To predict that the central role of macrophages in the destruction of the synovial fluid that causes arthritis is a monoclonal antibody or inhibitors of α d function for α d can exhibit therapeutic efficacy in the treatment of this disease. As in other models introduced previously, prophylactically administered α d monoclonal antibodies or small molecule inhibitors are expected to block or alleviate joint inflammation and prevent synovial destruction. Agents that block α d function can also alleviate ongoing inflammation by preventing further recruitment of macrophages to the joint or by blocking macrophage activation. The net result is recovery of ongoing joint destruction and facilitating tissue repair.
    [680] Multiple sclerosis
    [681] The pathogenesis of multiple sclerosis (MS) is still unclear, but the general idea is that the disease is mediated by CD4 + T cells that recognize autoantigens in the central nervous system and initiate inflammatory cascades. The resulting immune response induces the recruitment of additional inflammatory cells, including activated macrophages that contribute to the disease. Experimental autoimmune encephalomyelitis (EAE) is an animal model that reproduces some aspects of MS. Recently, monoclonal antibodies reactive with CD11b / CD18 present on inflammatory macrophages [Huitinga et al., Eur. J. Immunol. 23: 709-715 (1993) has been shown to block clinical and histological diseases. This result suggests that antibodies or small molecule inhibitors to α d may be effective in blocking inflammatory responses in EAE. Such agents also have important therapeutic utility in the treatment of MS.
    [682] Immune Complex Alveolitis
    [683] Alveolar ducts, airways, connective tissue, and alveolar macrophages located in the thoracic cavity of the lungs are the primary line of defense against inspired environmental substances. In response to stimulation by agents including bacterial derived LPS, IFN-γ and immune complexes, alveolar macrophages release a variety of powerful inflammatory mediators, including highly reactive oxygen radicals and nitrogen intermediates. Peroxide anions, hydrogen peroxide and nitric oxide (NO) play important functions in killing pathogens and dissolving tumor targets, but these substances can also have deleterious effects on normal tissues.
    [684] In rat models of immune complex alveolitis, NO release from alveolar macrophages has been shown to mediate much of lung damage (Mulligan et al., Proc. Natl. Acad. Sci. (USA) 88: 638-6342 (1991)). . NO is involved as a mediator in cutaneous vasculitis and other immune complex mediated wounds (Mulligan et al., Supra), and may play a role in diseases such as glomerulonephritis.
    [685] NO-mediated tissue damage is not limited to inflammation, including immune complexes. For example, microglia stimulated by substances such as PMA, LPS or IFN- [gamma] produce NO at levels capable of killing oligodendrocytes [Merrill et al., Immunol. 151: 2132 (1993). Pancreatic islets have also been identified as being sensitive to NO. Macrophage release of this mediator has been implicated in tissue damage causing diabetes (Kroncke et al., BBRC 175: 752-758 (1991)). More recently, NO release has been shown to play a role in endotoxin shock (MacMicking et al., Cell 81: 641-650 (1995)). When lipopolysaccharide (LPS) is administered, normal wild-type mice experience severe progressive arterial pressure reduction leading to death. However, mice lacking inducible nitric oxide experience much less reduction in arterial pressure on LPS and survive all of these treatments.
    [686] In vitro analyzes indicate that effective at blocking some aspects of macrophage (or leukocyte which express α d general) activation, including blocking of α d for NO release. Alveolar macrophages stimulated with IFN-γ in the presence of anti-α d polyclonal anti-serum (produced in rabbits for rat α d I domain polypeptides) degrade NO than macrophages treated with control anti-serum. It was found to produce much less nitrite / nitrate product. These findings indicate that monoclonal antibodies against α d , in particular I-domains, can be used as effective anti-inflammatory agents in MS, diabetes, pulmonary inflammation and toxin shock. In addition, the CD18 as opposed to the effect on a broad range of leukocyte functions, limited distribution of α d is this a more attractive target than CD18 according to preventing macrophage (or generally white blood cells expressing α d) activation To be.
    [687] Rat IgG immune complex induced alveolitis is a widely used experimental model that is important for understanding acute lung injury. Injury is caused by intravenous injection of BSA following injection of anti-bovine serum albumin (BSA) antibody into the lung via tracheal cannula insertion. Formation of immune complexes of the microvessel structure of the lung leads to the activation of complement and mobilization of neutrophils into the lung. Perhaps, after the outflow of leukocytes from the blood, an immune complex is formed, which then is thought to migrate through the lung epithelium. Subsequently, mediators, including radicals, TNF-α and nitric oxide (NO), are released from activated endothelial cells, neutrophils and macrophages participating in disease progression. Pathological features of this disease include edema due to increased vascular permeability and the presence of multiple red blood cells and PMNs present in the alveolar cavity.
    [688] Polyclonal anti-serum specific for the I-domain of α d was tested in a rat model of immune complex induced alveolitis. Anti-α d polyclonal serum was administered via tracheal cannula insertion and at the same time anti-BSA was administered to the lung. Thereafter, BSA and a small amount of 125 I-labeled BSA (approximately 800,000 cpm) were administered intravenously to induce lung injury to quantify edema resulting from lung injury. Lung damage was allowed to progress for 4 hours, and damage was assessed using lung permeability values, defined as the ratio of 125 I-labeled BSA present in the lung to the amount of label present in 1.0 ml of blood. Lung permeability values for positive control grades are generally 0.6-0.8, while permeability index values for negative controls (rats not administered BSA) are 0.1-0.2.
    [689] The first study showed that treatment with anti-α d polyclonal anti-serum reduced lung permeability by more than 50%, indicating that lung damage was rapidly alleviated. In previous studies, treatment with anti-CD18 reduced permeability values by 60%. These findings indicate that α d may be the most important β 2 integrin during acute lung injury, but it is not possible to determine exactly whether anti-serum can prevent leukocyte leakage from blood or migration through the lung epithelium.
    [690] As another evidence that a d alleviates lung damage, TNF-alpha concentrations in bronchoalveolar lavage fluid were evaluated. Treatment with anti-α d anti-serum was found to reduce TNF-alpha concentration by about 4 fold. TNF-alpha has long been regarded as an important mediator in acute lung inflammation, which serves to recruit inflammatory cells to sites of inflammation, cell activation and tissue damage. Presumably, anti-α d anti-serum mitigates the release of TNF-α and NO by blocking the activation of endogenous alveolar macrophages during the formation of immune complex alveolaritis, and prevents the recruitment of subsequent tissue damage and neutrophils caused by these substances. It is thought to reduce.
    [691] F344 rat model of LGL leukemia
    [692] LGL leukemia in F344 rats was first introduced in the early 1980s as a transplantable leukemia with stable NK cell activity. This leukemia has been proposed as a possible model for human T lymphoma and T-cell chronic lymphocytic leukemia [Ward and Reynolds, Am. J. Pathol. 111: 1-10 (1982); Stromberg, Am. J. Pathol. 119: 517-519 (1985); Reynolds et al., J. Immunol. 132: 534-540 (1984). This model provides enough cells for the study of LGL and NK cell function. Of particular importance is the presence of a d on the surface of these cells as detected using hamster anti-rat antibody 205C via the FACS analysis described in Example 26. In view of this observation, the role of α d in vitro (eg, using the above-described cytolysis assay) and in vivo role were investigated.
    [693] Pathological features of LGL leukemia include severe splenomegaly, soft spots of liver, dilatation of peripheral lymph nodes and spotted hemorrhages of lung, brain, and lymph nodes. α d is present in the erythrocytes of normal rat spleen (on the spleen macrophages), and because LGL leukemia is characterized by severe splenomegaly, α d- positive NK tumor cells are “received” or bound to already defined ligands. It was assumed that it could be amplified in place. To test this hypothesis, tumor cells were labeled with radioactivity and either the rats were injected with or without the α d antibody. After 3 hours the spleens were removed from these animals to confirm the presence of NK tumor cells. A more detailed description of the method used and the experimental results follows.
    [694] Tumor cells obtained from the spleens of rats with LGL leukemia and prepared as described below were adoptively delivered to receptor rats 2-4 weeks before each experiment. From previous studies by histology and FACS analysis, rapid proliferation of tumors and consequent splenomegaly are known to occur three to four weeks after adoption delivery. In the first experiment, spleens were removed from animals exposed to tumor cells for 4 weeks. The spleen was chopped into smaller pieces with scissors and these pieces were passed through a network screen in the presence of D-PBS to make a single cell suspension. The cell suspensions were collected in 50 ml tubes and centrifuged for 10 minutes at 1500 rpm at room temperature in a Beckman tabletop centrifuge. The supernatant was discarded and the cells were resuspended in 30 ml of D-PBS. About 5.0 ml of the cell suspension was stacked on 5.0 ml of histo fake and gradient centrifuged at 1500 rpm for 30 minutes. Cell layers were recovered from these gradients, collected, and counted in the hemocytometer. The cell number was adjusted to allow each receptor rat to receive 1.0 × 10 7 cells, and was set slightly higher to account for cell loss in the wash and preparation syringes. The cells were suspended in NK "test medium" (RPMI-1640 + antibiotics + 2% FBS) and labeled with 51 chromium 10 mCi at 37 ° C for 1 hour. After incubation, the cell suspension volume was increased to 50 ml by addition of test medium and the cells were pelleted by centrifugation at 1200 rpm for 10 minutes. The supernatant was discarded and the cells washed twice more as described above. Labeled cells were suspended to a final concentration of 1 × 10 7 cells / ml and injected into recipient rats after preincubation with or without anti-rat α d and control IgG antibodies. The final concentration of antibody used per animal was adjusted to 5.5 mg / kg, ie about 1 mg / animal. At least four animals were used for each condition.
    [695] Receptor rats were weighed and anesthetized by subcutaneous injection of 150-200 μl of ACE solution (containing 0.25 ml of ketamine, 0.2 ml of Ace and 0.8 ml of rompin). Per each antibody treatment. 1.0 x 10 7 cells were injected into the vein of the animal. About 300 μl of each cell suspension was observed using a gamma counter to determine the total cpm / rat injected. The labeled NK cells were allowed to circulate in the rat's circulation for 3 hours, after which the animals were killed and 1.0 ml of peripheral blood was drawn by aortic puncture. The spleen was removed from each animal and measured using a gamma counter. Total minute per minute (cpm) / spleen was divided by the known total cpm injected into the rat to determine the emptying of cells returned to the spleen. To measure cpm in peripheral blood, it was assumed that blood accounts for about 6.0% of the total rat body weight. Total cpm in blood was measured by multiplying cpm in 1.0 ml blood by 6.0% of the total body weight of the animal. This number was then divided by the total number of cpm injected into each animal to obtain the percentage of cpm remaining in the blood.
    [696] In the first experiment, antibodies 226B, 226G, 226H, 226I, 20C5B (non-blocking CD18 antibody) and control antibody were used. Antibodies 226B and 226G were found to significantly reduce the number of cells returning to the spleen compared to the control antibody and the other two 226 antibodies, with approximately 7-8% of labeled cells incubated with the control antibody and then to the spleen. On the other hand, about 6% of the cells returned to the spleen after incubation with 226B and 226G antibodies. The percentage of total cpm in blood, 0.9-1.4%, showed no significant difference between treatment groups except 226B (which is lower than all other groups).
    [697] In the second experiment, some adjustments were made to the protocol described above. First, the number of animals per condition was increased to four, and second, the spleen from tumor bearing rats was removed 2.5 weeks rather than 4 weeks after adoptive transfer as described above. NK cells were prepared in exactly the same manner as described above and injected into receptor animals and then incubated with antibody 226B or 226G or control antibodies in the amounts described above. In addition, the animals were killed after circulating the labeled cells for 3 hours, and blood and spleen were recovered as described above. In addition, tissue was removed from two animals per condition to determine other locations of tumor cells. These tissues include the liver, brain, thymus, lungs, long bones (for bone marrow) and kidneys.
    [698] The results showed that about 32% of tumor cells in the control IgG1 were present in the spleen, while 226B and 226G reduced the number of labeled cells in the spleen by 28% and 29%, respectively. The proportion of cells in the blood was similar for each antibody, with 3-4% of the total cpm observed in the blood, with 226G antibody treatment slightly less than in the other two groups.
    [699] Tissue distribution was similar between treatment groups with liver representing 27% of total cpm, brain representing 0.05%, thymus representing 0.10%, lung representing 15%, kidney representing 0.80% and long bone representing 1.3%.
    [700] In the third experiment, the number of animals per condition was increased (n = 6 or 7), allowing statistical differences between the treatment groups described above to be detected. In addition, spleens from animals injected with tumor cells two weeks before the experiment were prepared in the same manner as described above. Cells were labeled in the same manner and injected into animals and allowed to circulate for 3 hours. In this experiment, because of the large number of animals used, only blood and spleen were recovered.
    [701] This result was observed in about 30% of labeled cells returned to the spleen in the control group, whereas only 25% of 226B antibody-treated cells and 27% of 226G antibody-treated cells were observed in the spleen. Matched. Blood values also did not differ significantly between groups, with about 17% of total cpm in the blood of the control group and 15.8% and 14.75% in the 226B and 226G treated groups, respectively.
    [702] Small adjustments were made in the fourth experiment to determine if 3 hours was the best time to observe differences between treatment groups. The cells were isolated and in the same manner as for receptor animal injections, but additional anti-CD18 antibody 20C5B was added to a series of test antibodies. In addition, only 4 animals were used for each condition. In this experiment, cells were allowed to circulate only 30 minutes after injection, at 30 minutes blood samples were collected and spleens were removed from the animals.
    [703] At 30 minutes, the total cpm in the spleen was reduced by 12-13% from the values observed in the second and third experiments. There was no apparent difference between all treatment groups in the spleen sample, but two out of four in the group treated with antibody 226B had slightly lower values. Blood values were also similar in all groups and were about 6-7% of the total cpm found in blood. The only significant difference between blood groups was a wider range in data values from 226B and 226G antibody treated animals. This observation suggests that α d plays a role in homing leukocytes into the spleen. Experiments show that homing takes several hours and maximum inhibition with α d specific monoclonal antibodies occurs at 3 hours.
    [704] Mercak model of multiple sclerosis and atherosclerosis
    [705] Monoclonal antibodies 212D and 217L were shown to cross-react with Mercak splenocytes by immunohistochemical staining and immunoprecipitation. Specificity of recognition was confirmed by immunoprecipitation and amino terminal sequencing of the α d species homologs from Mercak spleen (Example 34). In view of this previous observation, two antibodies were used to stain tissue obtained from Mercak for experimental autoimmune encephalomyelitis (EAE) or atherosclerosis studies. Both of these diseases are characterized by infiltration into lesions of phagocytic macrophages that uptake myelin basic protein (MBP) in EAE and uptake low density lipoproteins in atherosclerosis. Macrophages containing MBP or lipids can be identified by morphology or by staining with Oil Red O (ORO) or the antibody Ham 56 (Capinteria, Dako, CA). The protocol used in these experiments is as described in Example 18 characterizing α d expression in human tissue.
    [706] Sections from the Mercak brain with EAE were characterized by infiltration of lymphocytes and macrophages. Expression of a d was concentrated in a subset of macrophages in ORO stained lesions, indicating that MBP had already been uptaken. Lesions negative for ORO staining were also negative for α d expression. This result suggests a direct correlation between ORO staining and α d . Similar results were observed with antibodies 217K, 217I and 217H.
    [707] Atherosclerosis lesions were obtained from the thorax or abdominal arteries of a high fat diet. The lesions appear in both areas of the human, but the pathological progression is located more in the abdominal aorta. The lesions tested in this experiment were separated into five different stages (I-V) and normal. Stage (IV / V) lesions were from the abdominal aorta and the remainder were from the thoracic aorta.
    [708] Early stage lesions (I / II) showed little macrophage infiltration and had low or no α d expression. In later stage lesions, bubble cell infiltration was more common and α d expression was detectable.
    [709] Staining patterns for different leuco integrin α chain subunits were overlapping with, but not identical, α d expression in both tissues. Most notably, expression of the α subunit of non-α d leucointegrin was detected on lymphocytes not stained with anti-α d antibody.
    [710] These results suggest that α d expression may be characterized by phagocytic macrophages in both animal models. However, it is not clear whether α d expression is directly involved in some downstream processes such as phagocytosis or antigen presentation.
    [711] Example 37
    [712] Α in the incubation model dExpression of
    [713] Tissue sections from animal disease models were stained with anti-α d polyclonal serum generated as described above (see Example 22) to assess different expressions of α d in various disease states. Tissues from normal and diseased rats were incised to a thickness of 6 μm and allowed to air dry overnight at room temperature on a Superfrost Plus (VWR Scientific) slide. After drying, the sections were stored at −70 ° C. until use. The slides were taken out at −70 ° C. and left at 50 ° C. for about 5 minutes before use. Sections were fixed for 10 minutes at room temperature in cold (4 ° C.) acetone (Stevens Scientific) and then air dried at room temperature. Each section is 150 μl of a solution containing 30% normal rat serum (Harlan Bioproducts), 5% normal goat serum (Vector Laboratories), and 1% bovine serum (BSA) (Sigma Chemical Company) in 1 × TBS. After 30 minutes of blocking at room temperature, the solution was removed by gentle blotting from the sections. Rabbit polyclonal serum with a protein concentration of 34 μg / ml and preimmune serum from the same rabbit with a protein concentration of 38.5 μg / ml were diluted in blocking solution and 100 μg was individually added to each tissue section at 37 ° C. for 30 minutes. This serum solution was removed by blotting from the sections and unbound antibody was removed by washing three times in 1 x TBS. Excess was washed last after blotting by removing TBS. Biotinylated goat anti-rabbit antibody (Jackson Laboratories) obtained from Elite Rabbit IgG Vectortastatin ABC Kit (Vector) was prepared according to the manufacturer's protocol, and 100 μl of the resulting solution was prepared at 37 ° C. for each section. Was added for 15 minutes. After slides were washed twice with 1 x TBS (5 minutes per wash), streptavidin-gold conjugate (Goldmark Biologics) diluted in 5% normal rat serum and 1% BSA was added to each section at room temperature. Was added for 1 hour. Slides were washed three times with TBS (5 minutes per wash) and 100 μl of 1% glutaraldehyde (Sigma) in TBS buffer was added at room temperature for 5 minutes. Slides were once again washed 3 times with TBS (5 minutes per wash) and 5 times with sterile deionized water (3 minutes per wash). Excess liquid was blotted off from each slide and two drops of each of the silver enhancement and starting solution (Goldmark Biologics) were added to each section. The reaction was allowed to proceed for 20-30 minutes at room temperature, after which the sections were thoroughly rinsed with sterile deionized water, air dried overnight at room temperature, and then mounted in Cytosyl 60 (VWR). As a control, tissue sections were labeled with monoclonal antibodies recognizing CD11a, CD11b, CD11c and CD18 in the same experiment by the same protocol.
    [714] Labeling with α d polyclonal serum and monoclonal antibodies against CD11a, CD11b, CD11c and CD18 showed staining patterns for α d different from those observed for other α subunits.
    [715] In normal lung tissues α d expression was detected on individual cells that appeared to be the respiratory epithelium of the bronchus (not the epithelium in the alveolar cavity) and alveolar macrophages in the lumen. The signal observed with polyclonal serum was significantly higher than the background signal levels labeled with pre-immune serum controls. In lung granulomatous tissues, different signals were detected in the α d stained respiratory epithelium throughout the alveolar area 24 and 96 hours after glycan administration, and more potent signals were detected in alveolar macrophages throughout the airways. In lung tissue from animals that appeared to recover from the disease (killed 16 days after glycan administration), no signal was detected with the α d antibody. In each of these tissues little background was detected in pre-immune serum.
    [716] Very potent signals were detected when using α d antibodies in the respiratory epithelium of both bronchial and alveolar cavities using rat lung tissue from an antigen-induced asthma model. This signal was significantly stronger than the background signal of pre-immune serum controls.
    [717] Latency model-L. monocytogen
    [718] Evidence is shown that α d positive macrophages in the splenic erythrocytes are involved in removing damaged red blood cells and other particles from the circulation. It is assumed that bacterial substances are also removed by α d positive macrophages in the splenic nasal fluid. Non-infectious agents that do not require induction of antigen specific T cell responses will be eliminated directly by the erythroid macrophages. In contrast, opportunistic infectious agents require the product of a T cell immune response for the eradication of bacteria. Thus, α d expression on erythrocyte macrophages regulates migration from the erythrocytes to the marginal zone of macrophages, or by acting as an adjuvant molecule involved in macrophage / T cell interactions that induce T cell activation. It is suggested that it can play a role in regulating / T cell interaction.
    [719] To investigate the role of α d in the immune response to infectious agents, the expression of α d in the spleen was examined using a mouse model of Listeria monocytogens . Expression of α d is observed on erythrocyte macrophages that eroded bacteria. It was also tested with antibodies to α d to identify the role of α d in inducing protective T cell responses against L. monocytogens.
    [720] Example 38
    [721] Α in spinal cord injury dRole
    [722] After central nervous system (CNS) trauma, the immune response utilizes invasive neutrophils, natural killer cells, and phagocytic monocytes / macrophages together [Means et al., J. Neuropathol. & Exp. Neurol., 42: 707-719 (1983). This response includes the release of inflammatory mediators, induction of reactive microglia, platelet infiltration, damage to endothelial cells with increased vascular permeability and the development of edema. Recent studies suggest that post-traumatic inflammation of the spinal cord contributes to chronic defects, in part by demyelination or more direct damage to neurons and axons. [Blight, AR, Central Nervous Systems Trauma, 2: 299-315 (1985). In addition, recent studies have reported that the number of macrophages / glial cells is significantly associated with the amount of tissue damage at each height of the spinal cord after impact injury [Carlson et al., Exp. Neurol., 151: 71-81 (1998). Both neutrophils and macrophages swallow debris, which leads to oxidative triggers that trigger the production of reactive oxygen species. Although these antiviral agents are effective, they can cause damage to surrounding healthy tissue. Thus, infiltration of leukocytes and generation of reactive oxygen species are likely to be involved in the spread of secondary damage beyond the site of initial impact. This hypothesis is supported by experiments that blocking neutrophils or macrophage infiltration can reduce the extent of injury after stroke or spinal cord injury (Blight, Neurosci, 60: 263-273 (1994)).
    [723] Full incision model
    [724] To assess the role of α d in spinal cord injury, a rat incision model was used in combination with a monoclonal antibody against α d , some of which block binding to ligand VCAM-1. In this model, a fourth thoracic spinal cord segment was completely incised, which consistently induces autonomic reflex insufficiency [Krassioukov et al., Am. J. Physiol. 268: H2077-H2083 (1995). This model is useful because small surgical lesions create a well-defined, narrow zone of primary tissue destruction that facilitates the analysis of the influence of the spinal cord on that zone.
    [725] All experiments were performed in accordance with the policy established in the "Guidelines for the Care and Use of Laboratory Animals" prepared by the Canadian Animal Control Board. Forty-two male wister rats (Charles River), weighing between 270 and 320 grams, were first administered by intraperitoneal injection of atropine (0.5 mg / kg) and diazepam (2.5 mg / kg). After 10 minutes, rats were anesthetized by intraperitoneal injection of sodium pentobarbital (35 gm / kg). Additional anesthetics (2 mg / kg) were injected as needed during surgery. Rats were placed on a heating pad during surgery and body temperature was maintained at 37 ° C. The dorsal protrusion of the third thoracic (T3) spine was removed and a vertebral incision was performed to expose the spinal cord under a microscope. The surgical mass blade was used to completely incise the spinal cord in the T4 ulnar segment. The muscles and skin on the vertebral incision are closed and the animals are recovered under a heat lamp. Twin-paralyzed rats were prepared postoperatively by known methods [Krassioukov et al., Neurosci. 70: 211-226 (1996). Upon recovery from the operation, feed and water were freely supplied. The animals survived for 2 days after surgery.
    [726] Rats (4-5 per group) were classified into the following groups: (1) α d monoclonal antibody 226H, 236L, 226B or unrelated isotype-corresponding IgG1 kappa antibody 1 mg / kg and (2) α d 5 mg / kg monoclonal antibody 226H, 236L or control 1B7. Each mouse received only one antibody, depending on the treatment.
    [727] Antibodies were selected according to in vitro binding assays using recombinant human VCAM-1 fused to immunoglobulin regions and CHO cell lines expressing ratα d and human CD18. Antibodies were examined for the ability of individual antibodies to block the binding of α d to VCAM-1. Binding assays showed that some antibodies did not block binding ("nonblockers") and some blocked 50% of binding ("intermediate blockers"), while others blocked binding in the range of 75% to 85%. ("Strong blockers"). Representative antibodies from nonblockers, intermediate blockers and potent blockers were selected for use as described below.
    [728] All monoclonal antibodies were injected through the tail vein 24 hours before surgery, 2 hours after surgery and 24 hours after surgery. Antibodies were diluted in phosphate buffered saline (pH 7.2) containing no calcium chloride or magnesium chloride to an appropriate volume to facilitate injection. In another control group, methylprednisolone (MP) was injected through the tail vein at a concentration of 30 mg / kg 30 minutes after complete incision of the spinal cord and 15 mg / kg after 2 and 24 hours. Another control rat also had a spinal cord incision as described above but did not receive concomitant treatment.
    [729] Two days after surgery, animals were deeply anesthetized with 3 g / kg urethane (Aldrich Chemical Company, Inc., Milwaukee, Wis.) Intraperitoneally before cardiac perfusion. After opening the chest cavity, heparin was injected into the left ventricle. Rats were perfused with oxygenated tissue culture medium, 250 mL of pH 7.4 (Dulbecco's Modified Eagle Medium; Gibco BRL) followed by 500 mL of 4% formaldehyde fixative in 0.1 M phosphate buffer (pH 7.4). The thoracic spinal cord (T4-8) in the coccyx was removed at the incision site and observed by a known method [Krenz and Weaver, Neurosci 85: 443-458 (1998)]. After overnight fixation in the same fixative, the spinal cord portions were cryoprotected at 4 ° C. with 10%, 20% and 30% sucrose solutions in PBS. Spinal cord portions were then cut into horizontal sections (50 μm) on a cryostat. Sections were stained with 1% cresyl violet (pH 4) using standard procedures to visualize polymorphonuclear leukocytes, xylene removed and coverslip with DPX mount (BDH Laboratories Surprise, UK Pool). It was. After Cresyl Violet staining, the number of rounded and phagocytic macrophages / microglia and neutrophils representing characteristic multilobed nuclei were counted in the ulnar region of the lesion site. Quantification of immune cells was performed using a 40 × objective lens equipped with bright field area microscope and grating (total area 0.08 mm 2 ). Three sample regions were observed for immune cells starting at the edge of the incised ulna and moving to the coccyx, from one side edge to the other. It was found that the mean area of total quantified spinal cord was 2.72 mm 2 by this procedure. This process was then repeated for other spinal cord slices. Since the inflammatory response was most pronounced in the gray matter, the sample area was chosen from the transverse sections of the ulna with the largest gray matter (the border between plates V and VII). The total number of macrophages and neutrophils counted in each sample area was divided by the total sample area (mm 2 ) to obtain the average number of macrophages and neutrophils per mm 2 in each treatment group. Antibody treated groups (1 mg / kg and 5 mg / kg) were compared with nondrug treated incision controls and the same amount of individual unrelated IgG counterpart controls. In another comparison, the groups with the most significant decrease in the average number of immune cells were compared with the MP treated and surgical control animals. All cell counts were performed without knowing which treatment group.
    [730] The results showed that blood macrophages identified as activated monoglia and / or mononuclear round cells with large clear cytoplasm were apparent at the lesion site after 2 days of dissection. Control animals not treated with α d antibody or corticosteroids were found to have 396 ± 26 macrophages / microglia per mean mm 2 at the ulnar injury site. Treatment of unrelated IgG1 antibody 1B7 at low dose (1 mg / kg) increased the number of macrophages / glia cells to 362 ± 43 per mm 2 , which was not significantly different from control animals not treated with antibodies. Did. Of the α d antibodies tested, 1 mg / kg of 226H and 236L significantly reduced the average number of macrophages per mm 2 compared to the 1B7 antibody and incision control, respectively. Specifically, as compared to the animals that are not animals and treatment administered to 1B7 226H administration 1 stylized mm 2 reduces the number of macrophage / microglia to 147 ± 17 per, 236L administration of macrophage / microglia per 1 mm 2 The number of is reduced to 131 ± 4. In contrast, injection of 1 mg / kg of α d antibody 226B reduced the number of macrophages / glial cells per mm 2 to 327 ± 65, which was not significantly different from the control values. MP treatment reduced the number of macrophages / glial cells per mm 2 to 250 ± 24, which was significantly less than control animals, but much more than that detected in animals treated with 226H and 236L α d antibodies. Since methylprednisolone is the most widely used drug for the clinical treatment of acute spinal cord injury, this result was unexpected.
    [731] Increasing the dose of α d antibody to 5 mg / kg, the number of macrophages / glial cells per mm 2 was significantly reduced compared to the control group when treated with 226H and 236L, but the number was unrelated to the IgG1 isotype. The numbers in the animals treated with the control antibody were not significantly different.
    [732] Results on neutrophil leukocytes (NL) indicated that the majority was detected in single or aggregated form throughout the gray matter. Only a small fraction of the observed NL was detected in the white ratio on each side of the gray matter. In addition, some neutrophils were found to adhere to the lumen surface of the ulnar and arterial artery of the ulnar tissue section. In the untreated animals, the average number of NLs per 1 mm 2 was 295 ± 56. In the 1 mg / kg 1B7 group, the number of NLs increased significantly to 426 ± 63. α d antibody treatment did not significantly reduce the number of NL compared to untreated control animals. Specifically, 1 mg / kg of 226H and 226B increased the number of NL per 1 mm 2 to 361 ± 80 and 332 ± 43, respectively. Treatment with 1 mg / kg of 236L and MP compared to 1B7 treated animals increased the number of NL per mm 2 to 270 ± 39 and 193 ± 39, respectively. However, this observation was not significantly different from that of the untreated control.
    [733] Treatment with 5 mg / kg 1B7 increased the mean number of NL to 343 ± 37, but this observed increase was not significant compared to the untreated animals. Compared to 1B7 treatment, antibody 226H reduced the average number of NL to 236 ± 38, but this reduction was not significant compared to the untreated animals. In contrast, 236L reduced the number of NL to 190 ± 17 per mm 2 , which was significant compared to animals treated with 1B7.
    [734] These results indicate that low doses of α d monoclonal antibodies reduce the number of leukocytes in the injured spinal cord, possibly by disrupting interactions with VCAM-1, which is consistent with previously reported observations. Other research reports using antibodies to the corresponding receptors for VCAM-1, VLA-4, the best known, have shown the reduction of VLA-4 positive cells into the brain and the prevention of clinical and pathological signs of experimental allergic encephalomyelitis (EAE). Reported. Similarly, anti-TNFα treatment has been shown to inhibit the onset and severity of EAE, and one mechanism of action was by significantly reducing leukocyte entry into the CNS by inhibiting VCAM-1 expression on spinal cord vessels. These previous observations suggest that blocking the interaction of α d on the surface of leukocytes with VCAM-1 on the surface of endothelial or glial cells may be the cause of the observed weakened inflammatory response.
    [735] Since 226H, one of the antibodies that blocks macrophages, failed to block the binding of α d to VCAM-1, these results include that the mode of inhibition by the antibody blocks binding between α d binding partners other than VCAM-1. Suggest that you can. One possibility is that there is a rat counterpart for ICAM-R. Previous observations show that in addition to VCAM-1, α d binds to ICAM-R, although much smaller than the affinity for VCAM-1. Interestingly, ICAM-R does not appear to be present on endothelial cells and is mainly expressed in endogenous monocytes, lymphocytes and neutrophils, which appears to prevent them from participating in leukocyte-endothelial adhesion under normal circumstances. It has been suggested that ICAM-R plays a role in the early stages of leukocyte cell-cell contact, and that ICAM-R is involved in the regulation of LFA-1 / ICAM-1 leukocyte intracellular interactions. The role of ICAM-R in early leukocyte interaction was found to be induction of cell aggregation. Breakdown of the initial contact leading to aggregation reduces the efficiency of the immune response. The interaction of other ligands with ICAM-R, LFA-1, leads to the conversion of LFA-1 to its activated state at the intracellular contact site. Co-expression of α d and ICAM-R on endogenous leukocytes plays many roles in the same way, and the interaction between the two proteins can promote contact dependent leukocyte activation. Conversely, disrupting interactions, such as with α d antibodies, can act as a cause of reduced entry of leukocytes into the spinal cord.
    [736] There are several explanations to understand the increase in macrophage infiltration. The simplest is that it can be the result of a phenomenon in the system. Alternatively, large amounts of antibodies can induce an early outbreak of chemokine production that induces crosslinking of FcγR on mature macrophages, leading to additional white blood cells at the site of injury. In the same way, chemokine production can explain an increase in the number of both neutrophils and macrophages at the site of injury after treatment with 1B7, which occurs in most cases. Another explanation for the observed results is that there may be variations between animals because the α d antibody has been tested in heterologous species of Wistar rats. For example, different groups of rats may have somewhat different immunocompetence. To test this possibility, experiments are run in duplicate using small and large amounts of monoclonal antibodies simultaneously in animals that are allogeneic or inbred.
    [737] Clip Compression Damage (CCI) Model
    [738] Another animal model for more clinically relevant spinal cord injury is the clip compression injury (CCI) model [Rivlin et al., Surg. Neurol. 10: 38-43 (1978); Maiorov et al., J. Neurotrauma 15: 365-74 (1998). In summary, rats were prepared as described above for a complete spinal cord incision that exposes the spinal cord by dorsal vertebral incision in thoracic segments T3 and T4. The modified aneurysm clip was used to compress the spinal cord by inserting the lower portion of the clip under the spinal cord between the spinal muscles of T3 and T4. The clip was then closed for 1 minute and then removed by opening the clip. Rats were then sutured with a suture chamber. These aneurysm slips have been specially modified such that they are close to the adjusted force. Clips were calibrated in this manner to induce severe spinal cord injury, intermediate spinal cord injury, or weak spinal cord injury. Severe, moderate and mild clip compression spinal cord injury models accurately and consistently reproduce all of the pathophysiological aspects of human spinal cord injury, including ischemia.
    [739] All experiments were performed using the procedure described above according to animal care and handling care. Rats exposed to severe CCI (50 g) were treated with one of the following 2, 24 and 48 hours after surgery: (i) 217 L of anti-α d monoclonal antibody (1 mg / mL), (ii) anti -α d monoclonal antibody 226H (1 mg / mL), (iii) anti-α d monoclonal antibody 236L (1 mg / mL), (iv) isotype control antibody 1B7, or (v) PBS (ratio) Treatment control). Group 6 rats received 30 mg / ml of methylprednisolone after 24 hours after CCI and 15 mg / ml of methylprednisolone after 24 and 48 hours. Four or five rats were observed for each treatment group. After 72 hours, animals were killed and perfused with fixative, after which the spinal cord was removed for further processing. The effectiveness of anti-α d monoclonal antibodies (217L, 226H and 236L) to reduce invasion of ED1 + (ie monocytes / macrophages) and infiltration of MPO + (ie phagocytes) to the site of injury was analyzed. ED1 + and MPO + cells were identified using two different fluorescent dyes by immunohistochemical staining. It was often difficult to distinguish between cells with neutrophil-like morphology and cells with macrophage-like morphology, so both were calculated as MPO + cells. In general, most MPO + cells appear to be neutrophils. The number of cells was counted on the damaged side (usually the coccyx). For each animal, 16 μm sections of one of every ten consecutive transverse sections cut across the entire spinal cord section were counted to span the wound. The results from this procedure indicate that a total of 6-10 fragments are calculated per animal.
    [740] The results of this analysis indicated a 40-55% reduction in invasive ED1 + cells at the site of injury after treatment with antibodies 217L and 226H compared to PBS treated animals or 1B7 antibody or 236L antibody control animals. Control animals receiving PBS or 1B7 antibody were found to have 681.3 ± 47.4 and 641.8 ± 77.8 ED1 + cells infiltrating severe CCI sites, respectively. Rats treated with 217L, 226H or 236L antibodies were found to have 388.6 ± 52.8, 291.9 ± 67.7 and 692.7 ± 98.4 invasive ED1 + cells, respectively, at the site of injury. Rats treated with methylprednisolone were found to have 409.0 ± 42.6 ED1 + cells at the site of injury. Statistical analysis of these results using two-way ANOVA showed significant improvement in the animals treated with 217L or 226H antibody, which was different from the control group (p <0.05). Similar analysis of invasive MPO + cells showed that 217L most consistently reduced migration of these cells to the site of injury when compared to untreated animals or animals treated with control antibody 1B7. Rats treated with 217L, 226H or 236L antibodies were found to have 156.5 ± 63.3, 191.3 ± 39.0 and 299.1 ± 44.0 infiltrating MPO + cells at the injury site, respectively. Control animals treated with PBS or 1B7 were found to have 615.3 ± 45.7 and 260.9 ± 48.92 invasive MPO + cells at the site of injury, respectively. However, since the peak time of neutrophil infiltration is generally around 18 hours after CCI, data obtained 72 hours after surgery may not reflect the effectiveness of anti-α d monoclonal antibodies in reducing neutrophil infiltration.
    [741] Similar experiments were also performed using rats exposed to moderate CCI (35 g). The results obtained in this experiment showed that animals receiving 217L antibody significantly reduced the number of invasive ED1 + cells as well as MPO + cells at the site of injury. Control animals administered PBS or 1B7 antibody were found to have 832.3 ± 69 and 1075 ± 87.94 invasive ED1 + cells. Rats treated with 217L, 226H or 236L antibodies were found to have 507.0 ± 51.4, 797.4 ± 65.1 and 761.2 ± 88.2 invasive ED1 + cells, respectively, at the site of injury. Irradiation of invasive MPO + cells at the site of injury in these animals confirmed that rats treated with 217L, 226H or 236L antibodies had 190.5 ± 28.4, 253.7 ± 45.2 and 301.4 ± 36.6 MPO + cells at the site of injury, respectively. . Control animals treated with PBS or 1B7 antibody were found to have 611.7 ± 140.5 and 247.6 ± 18.1 MPO + cells at the injury site, respectively.
    [742] Anti-α dExercise Score for mAb Treated Rats
    [743] Four rats were exposed to severe CCI and treated with antibodies as described above. Restored exercise assessed by Basso, Beattie, Bresnahan (BBB) 21 scoring method [Basso et al., J. Neurotrauma 12: 1-21 (1995)] on days 1, 7, 10, 14, 17, and 19 postoperatively Rats were evaluated for ability. In summary, the BBB score calculation is based on three general stages of recovery following spinal cord injury. Early stages where little or no hindlimb movement is observed, intermediate stages characterized by unnatural gait, late stages in which animals pull toes and tails, trunk instability, and plantar rotation. Further categorize each of the three stages into categories characterized by specific behaviors. Rats 41C450 and 42C50 were evaluated over 19 days and rats 44C50 and 45C50 were evaluated over 17 days. Horizontal bars at 14 day evaluation represent mean BBB scores obtained by untreated rats with the same severe damage. Scores on both sides of each rat indicated that compression damage was applied uniformly to the spinal cord.
    [744] Three of the four rats tested showed significant improvement in motor capacity recovery compared to untreated rats. In addition, by day 17 all four rats had restored a certain level of bladder control.
    [745] Evaluation of Autonomic Reflex Dysfunction in Rats with CCI
    [746] The same four rats described above were evaluated for autonomic reflex insufficiency by dilatating the colon [Mairov, D.N. Et al., J. Neurotrauma 15: 365-374 (1998). This evaluation began on day 17 for rats 44C50 and 45C50 and on day 19 for rats 41C50 and 45C50. Simultaneous recording of heart rate (HR), arterial pressure (AR), and mean arterial pressure (MAP) was performed twice a day for two consecutive days beginning with the day of arterial cannula insertion. Administration of 217L antibody to severely damaged rats showed that colonic dilation reduced the effect of arterial pressure by about 50%. Untreated damaged rats had an average increase of 42 ± 3 mmHg from a base pressure of about 100 mmHg. In contrast, animals treated with similarly damaged 217L antibodies showed an increase in mean MAP of 22 ± 3 mmHg. The mean heart rate (HR) of the untreated remaining rats with CCI was 515 ± 16 beats / minute. This HR value dropped to 124 ± 13 beats per second after induction of autonomic reflex failure during colon dilation. The average heart rate of the remaining four rats treated with 217L antibody was 544 ± 9 beats / min. After induction of autonomic reflex insufficiency due to colon dilation, it dropped to 117.7 ± 18. Therefore, there was no statistically significant difference between HR and untreated rats treated before and after induction of autonomic reflex insufficiency, which indicates that the change in heart rate in response to colonic dilatation is caused by parasympathetic vagus It may be due to the fact that it happens.
    [747] Anti-α after 12, 24, 48 hours of injury dObservation of Rats Treated with Monoclonal Antibodies
    [748] If initial administration of anti-α d antibodies can be delayed until 12, 24, 48 hours after spinal cord injury and is still effective, this would be useful because the time frame for delivery of effective therapeutics can be extended. To investigate this possibility, rats exposed to severe or moderate CCI were treated with (i) PBS, (ii) 1B7 antibody, or (iii) anti-α d monoclonal antibody as described above, with the exception of antibodies. Was administered 12 hours after CCI (following injection of antibodies at 24 and 48 hours after CCI) or 24 hours (following injection of another antibody after 48 hours after CCI). Similar experiments were performed in which the antibody was administered only 48 hours after CCI. The number of ED1 + and MPO + cells is assessed using the method described above. If administration of the anti-α d antibody is delayed by 12, 24, or 48 hours after CCI, and animals significantly reduce the number of invasive ED1 + and MPO + , treatment with this antibody begins after a period of time after injury. can do.
    [749] ED1 for the damaged area +And MPO +Anti-α to reduce infiltration of dComparison of efficacy of single injection and three injection regimens of antibody
    [750] Treatment with a single dose of antibody would be advantageous over using a three dose regimen. Single dose therapies are less expensive, the treatment procedure is simple, and the incidence of possible side effects may also be reduced. Based on the results of the experiments performed as described above, the optimal time for antibody administration is determined. Rats exposed to severe or moderate CCI are injected with anti-α d antibody, control 1B7 antibody or PBS once 2 hours after CCI or at the optimal time determined by analyzing the above results. Rats are killed 72 hours after injury and the number of ED1 + and MPO + cells at the site of injury is analyzed. The effectiveness of a single dose therapy is determined by comparing the results of the animals given a single dose with the results of the animals treated with the three dose regimens.
    [751] Anti-α in reducing peak neutrophil infiltration to the site of injury dInvestigation of the efficacy of monoclonal antibody therapy
    [752] The general peak of neutrophil infiltration appears 18 hours after injury and then rapidly decreases to a much lower sustained level. To determine whether treatment with anti-α d antibodies reduces neutrophil infiltration to the site of injury, rats were treated with anti-α d antibodies, control 1B7 antibody or PBS 2 hours or 12 hours after CCI, and then CCI Animals are killed 18 to 20 hours after (severe or medium). The number of neutrophils infiltrated into the site of injury was then counted to analyze the effect of the administration of anti-α d antibody during peak neutrophil infiltration.
    [753] Exposure to CCI and anti-α dObservation of Motor Ability and Autonomic Nervous Reflex in Rats Treated with Antibodies.
    [754] The optimal treatment was determined based on the results of the above described experiment. Optimal treatment was used to treat rats exposed to severe or moderate CCI with PBS, control 1B7 antibody or anti-α d antibody. Every three days after injury, rats were assessed for athletic performance using the standard BBB score calculation described above. After 3 weeks of CCI, a subset of animals was tested for autonomic reflex insufficiency and the remaining rats were assessed for motor performance after 3 weeks. Autonomic reflex failure was evaluated as described above.
    [755] Example 39
    [756] Α in Crohn's disease dExpression of
    [757] Previous experiments (Example 18) showed that leucointegrin was detected at high concentrations in tissue sections from Crohn's disease patients. To assess the degree to which α d expression is regulated in Crohn's disease, expression in tissue sections from affected and normal colons was examined as follows.
    [758] Colon tissues from 5 people with Crohn's disease and normal colon were cut to a thickness of 6 μm and air dried on a Superfrost Plus (VWR Scientific) slide for 5 minutes at room temperature. Slides were stored at −20 ° C. until analysis was performed. The slides were incubated at 50 ° C. for about 2 minutes before use. Sections were fixed in cold (4 ° C.) acetone (EM Science) for 2 minutes and then air dried at room temperature. Sections were placed in a buffer containing 100 ml of 1 × TBS, 1.1 ml of 30% H 2 O 2 (Sigma) and 1.0 ml of 10% NaN 3 (Sigma) to remove endogenous peroxidase activity. Each section was blocked for 30 minutes at room temperature in 150 μl of blocking solution containing 20% normal human serum (Boston Biomedica), 5% normal rat serum (Halan), and 2% BSA (Sigma) in 1 × TBS. After incubation, the solution was removed by gentle blotting from the sections. Primary monoclonal antibodies were prepared at a protein concentration of 10 μg / ml in blocking solution and 75 μl was added to each tissue section for 1 hour at room temperature. After incubation, sections were washed three times in 1 × TBS (5 minutes per wash) to remove unbound antibody. The excess was finally washed by aspiration after removal of TBS. Biotinylated rat anti-mouse antibody (Jackson Laboratories) was diluted 1: 400 in blocking solution and 75 μl was added to each section for 30 minutes at room temperature. Slides were washed twice with 1 x TBS (5 minutes per wash). Perlase conjugated avidin / biotin complex (Vector Laboratories) was prepared by adding 9 μl of Reagent A and 9 μl of Reagent B (both provided by the manufacturer) to 1 × TBS 782 μl and 75 μl of the resulting mixture. Was added to each section for 30 minutes at room temperature. Slides were washed twice with 1 x TBS (5 minutes per wash). Substrate 3,3'-diaminobenzidine (DAB) (Vector Laboratories) was added and the color reaction was stopped by immersion in water. One drop of 1% osmic acid (VWR) was added to each section for about 15 seconds to enhance signal strength, and the reaction was stopped by immersion in water. Sections were counterstained in Gil Hematoxylin # 2 (Sigma), rinsed in water and mounted with Cytosyl (VWR).
    [759] No labeling was detected in the normal colon when antibody 217L, 217K, or 212D was used. Antibody 240I labeled a number of cells in lymphocytes and neutrophils interspersed with lymphoma aggregates and lamina propria. Antibody 240I also labeled cell types that appear to be macrophages or activated lymphocytes. Staining with antibody 169A was similar to staining with antibody 240I. Antibody 169B labeled lymphocytes and macrophages scattered in the lamina propria and subpopulations of smooth muscle cells around the arteries and extramuscular tissues.
    [760] When Crohn's disease colon samples were used, the labeling patterns observed with individual antibodies were overlapping, but the expression patterns were not identical. No labeling was detected when antibody 212D or 217K was used. Antibody 240I labeled granuloma with differential expression on multinuclear giant cells in lymphoma aggregates and labeled lymphocytes in lymphocyte aggregates. Antibody 240I labeled neutrophils and lymphocytes scattered in the lamina propria. Antibody 217L also labeled granulomas with differential expression on multinuclear giant cells in lymphoma aggregates. Antibody 217L labeled a small subset of lymphoma in the lamina propria and submucosa, also labeled with 240I. The staining pattern of antibody 169A was very similar to that observed for 240I, except that 169A labeled fewer lymphocytes. Antibody 169B staining was similar to the 169A pattern, except that 169B also labeled a subset of smooth muscle cells outside the muscle tissue and around the blood vessels.
    [761] Example 40
    [762] Rat Spleen α d +TNFα release from cells
    [763] About the ability to produce cytokines during stimulation αd +The following experiments were performed to characterize the unique spleen subpopulations of cells.
    [764] Lewis rats were injected subcutaneously with 100 μl of a 1: 1 emulsion in complete Freund's adjuvant (CFA) in PBS into the posterior flank and animals were killed 7 days later. The spleens were recovered and single cell suspensions were prepared according to standard procedures. CD4 (antibody W3 / 25, EAACC No: 84112002), CD11b (antibody OX42, EAACC No: 87081803) and CD45Ra, which had previously conjugated B cells, CD4 + T helper cells, and macrophages on anti-mouse IgG magnetic bead conjugates It was selectively removed using a monoclonal antibody against / b (antibody OX33, paminegen). CD4 antibodies identify T cells, CD11b antibodies recognize macrophages, monocytes, granulocytes, and natural killer cells, and CD45Ra / b antibodies recognize B cells, T cell subsets, monocytes, granulocytes and macrophages. Thereafter, the cells coated with the antibody are removed using a magnet. Non-adherent cells are harvested, positive selected using biotinylated rat anti-α d + monoclonal antibodies 205C and 226G, and then incubated with streptavidin magnetic beads. Antibody-coated cells are collected using a magnet and suspended at 5 × 10 5 cells / ml in growth medium (2% normal Lewis rat serum, penicillin / streptomycin sodium pyruvate; RPMI 1640 with L-glutamine) Let's do it.
    [765] 2 ml of the cell suspension was coated with 3 μg / ml anti-rat CD3 monoclonal antibody (G418, paminegen), unrelated control antibodies, or added to individual wells on 24-well plates containing no antibody. The plates were incubated at 37 ° C. in 7% CO 2 and the supernatants were recovered from each well after 20 hours, 48 hours and 72 hours. After recovery, the supernatant was separated and immediately stored at -70 ° C. Anti-rat TNFα detection assay (biosource) was performed by diluting the supernatant 1: 2 prior to analysis.
    [766] The results indicate that after stimulation with anti-CD3 monoclonal antibody, α d + cells release about 280 pg / ml of TNFα after 20 hours, whereas the antibody control and media only group received about 40 pg / ml. It was released.
    [767] Example 41
    [768] Α of TNFα release from activated splenocytes dModulation with Antibodies
    [769] In order to evaluate the role of α d + phagocytic splenocytes in the inflammatory response, the following experiment was performed.
    [770] αd +Since spleen macrophages have already been reported to swallow magnetic particles injected into rats, these types of cells were collected in the following manner. Four mice were injected intravenously with 200 μl of magnetic bead suspension (conjugated to amines, Perspective Biosystems). After 24 hours, the spleen was taken out and the tissue was passed through a wire mesh screen to prepare a single cell suspension. The cells were separated using a magnet, washed once in PBS containing magnesium and calcium, placed in RPMI / 10% FBS culture medium, and cultured under the following six conditions: (i) untreated; (ii) mouse αdWow Cross Responsive Hamster Anti-αdMonoclonal antibody 205C (10 μg / ml); (iii) mouse αdWow Cross Responsive Hamster Anti-αdMonoclonal antibody 205E (10 μg / ml); (iv) lipopolysaccharide (LPS); (v) LPS and monoclonal antibody 205C (10 μg / ml); (vi) LPS and also mouse αdWow Cross-react monoclonal antibody 205E (10 μg / ml).
    [771] As described above, cells were first treated with antibody for 30 minutes and then 200 μl of conditioned media sample was collected to represent the initial time point (t = 0). LPS (10 ng / ml) was then added to the wells as described above, and medium separations were recovered after 0.5, 1, 2 and 4 hours and released by ELISA using a rat TNFα kit (ENDOGEN, # 005452). Was analyzed for TNFα. After collection, samples were immediately frozen and stored until analysis. The conditioned medium was diluted 1: 1 and immediately before analysis and analyzed according to the manufacturer's protocol.
    [772] The results showed that splenocytes not activated with LPS did not significantly release TNFα into the medium regardless of prior antibody treatment. Splenocytes treated with LPS released TNFα into the medium at detectable levels, whereas cells activated with LPS treated with 205C or 205E antibodies released significantly reduced levels of TNFα. These results were consistent across all time points and confirmed in subsequent iterations. In addition, the same results were observed in subsequent experiments using splenocytes not isolated using magnetic beads. Finally, preliminary results showed that IL-1β release from splenocytes was similarly inhibited by anti-α d monoclonal antibodies.
    [773] Example 42
    [774] Α on eosinophils dCharacterization of expression
    [775] Previous observations have shown that a d is expressed in all peripheral blood eosinophils (Example 18). To further investigate the expression and function of α d in human eosinophils, the following analysis was performed.
    [776] Α on human granulocytes dExpression of integrin
    [777] Expression of α d on human granulocytes was observed on cells prepared as follows. Normal density eosinophils (ie, those with a normal specific gravity greater than or equal to 1.09) were isolated from peripheral blood of volunteers of allergic constitution by density gradient centrifugation, low osmotic erythrocyte lysis, and immunomagnetic negative selection as known [Hansel et al. Immunol. Meth. 145: 105 (1991). Neutrophils were isolated from peripheral blood of normal volunteers using only density gradient centrifugation and low osmotic erythrocyte lysis (Bochner et al., J. Immunol., 145: 1832 (1990)). Individual purity of cell type always exceeded 95%. Concentration of peripheral blood to basophils was performed using double percol density gradient separation, thereby increasing the number of basophils to 3-10% of the total white blood cell count [Bochner et al., J. Immunol. Meth. 125: 265 (1989). Expression of integrins on cells freshly isolated from blood after stimulation in culture was assessed using known monochromatic indirect immunofluorescence and flow cytometry [Bochner et al., J. Immunol. Meth. 125: 265 (1989); Matsumoto et al., Blood 86: 1437 (1995). Double staining detection (using anti-IgE) of basophils was also performed. All samples were fixed in 0.1% paraformaldehyde (Sigma) and analyzed using EPICS Profile II flow cytometry (Coulter). About 10,000 forms were collected and displayed on a 4-log scale yielding median fluorescence intensity (MFI) values.
    [778] The results show that eosinophils express all four of the β 2 integrins. The surface expression level of α d integrin was higher than that of CD11c, but less than that of α 4 integrin (CD49d), CD11a, or CD11b. The results also showed that basophils expressed slightly more α d integrins than neutrophils.
    [779] Α on human eosinophils dRegulation of Integrin Surface Expression
    [780] Initial experiments were performed to determine if eosinophils could rapidly move the intracellular reservoir of α d β 2 as previously reported for neutrophils (Van der Vieren et al., Immunity 3: 638 (1995)). Peripheral blood eosinophils purified as described above were incubated with PMA or calcium ionophores A23287 for 15 minutes and surface expression of several α chains of the β 2 integrin family was measured by indirect immunofluorescence as described above.
    [781] The results showed that both 50 ng / ml PMA and 1 μM calcium ionophore significantly increased the expression of α d and CD11b. PMA was added and expression increased within minutes, reaching a markedly increased level by 10 minutes. This observation suggests that eosinophils possess a cytoplasmic reservoir of α d β 2 that can be rapidly migrated to the cell surface, similar to the CD11b reservoir.
    [782] In light of these results, we tested whether other eosinophil activity stimuli also rapidly affected the expression of α d β 2 . Incubation of eosinophils with MDC (100 nM), IL-5 (10 ng / ml), RANTES (100 ng / ml) and eotaxin (100 μM) for 15 minutes did not alter α d integrin expression.
    [783] Previous observations have shown that many eosinophil responses can be augmented with a phenomenon called “priming” upon prolonged exposure to certain cytokines such as IL-5 [Walsh et al., Immunol. 71: 258 (1990). Therefore, experiments were planned to investigate whether priming of eosinophil cultures with IL-5 altered the surface expression of α d integrins. Purified eosinophils prepared as described above were incubated with 10 ng / ml of IL-5 for 4 days and analyzed for the expression of various integrins as described above.
    [784] The results showed that the expression of α d integrin on the cell surface increased 4-5 fold, while the α 4 integrin expression level remained unchanged. The rate of increase of α d integrin expression showed a statistically significant increase in expression after 4-7 days of culture. In contrast, the level of α 4 integrin did not show a significant change. The rate of increased α d expression by exposure to PMA was similar to that of CD11b, suggesting that these two leucointegrins may be present in similar or identical intracellular compartments. The location of this compartment relative to integrins in eosinophils is unknown, but in neutrophils the preformed reservoir of CD11b was concentrated in certain granules [Todd et al., J. Clin. Invest. 74: 1280 (1984); Bainton et al., J. Exp. Med. 166: 1641 (1641).
    [785] Late bronchoalveolar lavage (BAL) eosinophils express many of the characteristics of eosinophils primed by cytokines [Krogel et al., Ann. Rev. Respir. Dis. 143: A 45 (1991); Sedgewick et al., J. Immunol. 149: 3710 (1992)], the expression of α d in this cell type was also observed. BAL cells were obtained from allergic patients who had been exposed to bronchial epithelial segment allergens for 18 hours with hives or D. petrynissinus extract as known [Kroegel et al., J. Clin. Allergy Immunol. 93725 (1994). The purity of eosinophils in late BAL fluid was 19 ± 4%.
    [786] The results showed that late BAL eosinophils also showed a statistically significant increase in α d integrin expression, similar to that observed after 3 days of stimulation with IL-5. When observing the level of α d integrins of late BAL eosinophils, ie, cells that have already undergone cell adhesion and migrated to reach the airway lumen, moderate expression was observed on newly isolated and cultured eosinophils with IL-5. . These data suggest that at least a portion of the increased levels of α d observed after incubation with IL-5 may be due to increased transcription and translation of α d integrins.
    [787] α dEosinophils expressing Binding to VCAM-1
    [788] α d integrins have been shown to bind to ICAM-R and are likely to mediate leukocyte-leukocyte adhesion (Van der Vieren et al., Immunity 3: 638 (1995)), but other possible ligands for α d expressed on eosinophils. An experiment was planned to investigate. In part because of previous studies demonstrating the attachment of β 2 integrin dependent CD11b dependent eosinophils to VACM-1 (Matsumoto et al., Blood 86: 1437 (1995)), the first experiment used immobilized recombinant VCAM-1. It was performed by.
    [789] For both freshly purified eosinophils and cultured eosinophils, 51 Cr-labeled cell attachment to VCAM-1 (250 ng / ml) or BSA (1%) coated wells was performed for 30 minutes at 37 ° C. according to the conventional method. Matsumoto et al., Blood 86: 1437 (1995). In some experiments, cells were preincubated for 30 minutes at 4 ° C. with saturation concentrations of one or more of the following blocking monoclonal antibodies before investigating adhesion: anti-CD18 (7E4), anti-CD11a (MHM24), anti -CD11b (clone 4), anti-CD11c (BU-15), anti-α d (240I) and anti-α 4 (HP2 / 1).
    [790] For transfected CHO cells and parental CHO cells, adhesion was carried out using the same coated plates used for eosinophil attachment. Observations of transformed CHO cells showed relatively low α d expression, indicating that the interaction between CHO transfectants and VCAM-1 was not as strongly detected as that between eosinophils and VCAM-1. Thus, already known weak washing techniques [Shanley et al., J. Immunol. 160: 1014 (1998). This technique allows centrifugation at 1 xg for 20 minutes at 20 ° C to allow nonadherent cells to fall off the inverted plate. The remaining adherent cells were then removed using 0.1 M EDTA (Sigma) and the cell number was counted by flow cytometry. In addition to VCAM-1, wells in some adhesion experiments were coated using E-selection (100 ng / ml). In addition to the blocking monoclonal antibodies used in the eosinophil experiment, immobilized VCAM-1 was pretreated with appropriate dilutions of F (ab ') 2 anti-VCAM-1 monoclonal antibodies before addition to CHO cells.
    [791] The results showed that the newly isolated eosinophils attached to VCAM- and monoclonal antibody blocking of α 4 integrins effectively inhibited adhesion. Blocking with anti-CD11b antibody was ineffective. In addition, adhesion was significantly persistently inhibited by anti-α d monoclonal antibody 240I, although to a lesser extent (about 30% inhibition) than observed with anti-α 4 antibodies.
    [792] More clearly were the results of VCAM-1 adhesion experiments using eosinophils cultured with IL-5 expressing increased levels of α d integrin. Under these conditions, antibodies against CD18, α d , or α 4 integrins reduced adhesion equally effectively to background levels, but the combination of blocking antibodies against CD11a, CD11b and CD11c was ineffective. In addition, eosinophils incubated with IL-5 showed increased background adhesion and reduced VCAM-1 adhesion compared to that observed with freshly isolated eosinophils. Based on monoclonal antibody blocking experiments with freshly isolated eosinophils, attachment to VCAM-1 was mediated primarily via α 4 integrins. However, in eosinophils incubated with IL-5, adhesion to VCAM-1 was equally mediated by α 4 or α d integrins. Taken together, this data is the first to demonstrate activation-dependent regulation of α d β 2 integrin expression and function on human eosinophils, and to report new functions for α d β 2 as another ligand for VCAM-1. .
    [793] Based on the results that α d integrins on eosinophils bind to VCAM-1 and can be upregulated using IL-5, these leuco-integrins play a role in recruiting eosinophils primed by cytokines to the site of inflammation. can do.
    [794] Example 43
    [795] α dExpressing CHO cells bind to VACM-1
    [796] To further verify that α d β 2 acts as ligand VCAM-1, CHO transfectants expressing human α d and β 2 integrin chains were generated as follows.
    [797] Chinese hamster ovary cells were transfected as described in Example 11. 1 mM pyruvate, supplemented with α d β 2 -transfected CHO cells with 10% dialyzed FBS, 100 U / ml penicillin, 100 μg / ml streptomycin and 600 μg / ml G418 (all available from Life Technologies) and The cells were cultured in DMEM / F12 medium containing 2 mM L-glutamine (Virofluid). Medium for culturing the parent CHO cell line was similar to that described above except that non-dialysis FBS (Life Technologies) was used, with 0.1 mM hypoxanthine and 16 nM thymidine (Sigma) in place of G418. The transfected cells expressed some degree of α d and β 2 integrin chains, but did not express CD11a, CD11b and CD11c, or α 4 integrins. The parent CHO cell line did not express any of these integrins. Attachment assay was performed as described in Example 42.
    [798] The results showed that α d β 2 -transfected CHO cells attached to wells coated with VCAM-1. Attachment was effectively blocked by F (ab ') 2 monoclonal antibodies against the first domain of VCAM-1 and monoclonal antibodies against CD18 or α d . In contrast, parental transfected CHO cells failed to attach to VCAM-1 and no cell type significantly attached to the wall coated with E-selectin.
    [799] The discovery that monoclonal antibodies against the α 4 integrin binding site of the first domain of VCAM-1 completely blocked α d β 2 integrin dependent VCAM-1 attachment showed that the α d β 2 binding site was similar or identical to that of α 4 integrin. It was a strong suggestion. Since there was little amino acid homology between α d and α 4 integrins, this result was unexpected. It is not known whether α d β 2 integrins can bind to other α 4 integrin ligands such as fibronectin or mucosal addressin cell adhesion molecule-1.
    [800] α dVCAM-1 area required for joining
    [801] The first two domains of VCAM-1 were found to support the binding of α 4 integrins, and related amino acids within these domains were identified. To confirm that a d shares a similar recognition site in the VCAM-1 molecule, a plasmid containing the sequences for domains 1 and 2 of VCAM1- fused to human immunoglobulin Fc was constructed. Modified forms of the two domain VCAM-1 expression constructs were also generated by PCR to include a substitution mutation in which alanine at residue 40 was replaced with an aspartate residue. Two expression constructs were transiently transfected into CHO cells using the known DEAE-dextran protocol. Protein A was purified from the culture supernatant using a known method using Sepharose®.
    [802] The ability of CHO cells expressing α 4 β 1 or α d β 2 to bind to the five domains VCAM-1 / Ig fusion protein or ICAM-1 / Ig fusion protein was tested as follows. CAM was fixed at 96 μg / well in bicarbonate buffer (pH 9.5) at 96 μg microtiter plates. Plates were blocked with 1% fish gelatin and treated with buffer, unrelated antibodies or blocking VCAM-1 antibodies. CHO cells transformed with α d or α 4 were either buffered or unrelated antibodies of monoclonal antibodies specific for the alpha chain (130K or 217I for α d , or α4.1 for α 4 ) or blocking Treatment with alpha chain antibody. After washing the cells, 100,000 wells per well were added to the wells coated with CAM. Cells were incubated for 20 minutes in the presence of immobilized antibody, followed by addition of 5% glutaraldehyde. After immobilization, the plates were washed with distilled water and the cells stained with 1% crystal violet. After destaining with 66% ethanol for several hours, absorbance was measured at 570 nm on a Dynatech plate reader.
    [803] The results show that both α d β 2 and α 4 β 1 recognize the same 5 domain and 2 domain forms of VCAM-1 to the same extent, suggesting that no additional domain is required for binding. Although differences between α d / VCAM-1 binding and α 4 / VCAM-12 binding have been identified, the difference appears to be due to differential expression in transformed CHO cells. Binding of both cell lines was blocked by VCAM-1 antibody (50-100%), α 4 antibody (100%) and α d antibody (50%). Cell lines transfected with α 4 did not recognize mutant VCAM-1 binding, and binding of the α d cell line to the mutation was 50% of that detected using wild type VCAM-1. CHO cell lines showed no binding of ICAM-1 / Ig. Summarizing these results, it can be seen that α d and α 4 recognize domains 1 and 2 of VCAM-1 and recognize epitopes that are overlapping but not identical.
    [804] Example 44
    [805] Α as a tumor antigen dTargeting
    [806] spatially and temporally restricted expression of α d is to suggest that this molecule can serve as a target for removal of onset source population of cells expressing α d on the surface. Several previous observations lead to this possibility.
    [807] For example, α d expression is less extensive compared to other leucointegrins. Expression of α d appears to be limited to specialized and / or highly differentiated subsets of leukocytes. Unlike other leucointegrins, α d expression appears to be controllable, as confirmed by rapid down regulation on primary cells or transformed cells in culture. monoclonal antibodies directed against the α d antibodies, even if that is specific for α d show variable reactivity. For example, anti α d antibody 212D exhibits limited responsiveness to normal tissues and highly differentiated myeloid cells as compared to the reactivity observed using other anti α D monoclonal antibodies 217L. It is interesting to note that knockout-α d mice survive until birth, but this observation provides little information about the biological function of α d . Finally, α d expression was detected in about 70% of canine leukemia and high levels of α d expression were detected in freshly isolated NK leukemia cells in F344 rats (Example 26). Tumor cells are the preferred population for removal when using α d as a target, while any undesirable cell type expressing α d may also be removed in the manner described below.
    [808] One or more antibodies are selected that tend to have low reactivity with normal tissues. One possibility would be antibody 212D for the reasons described above. Appropriate control antibodies were also selected by including unrelated antibodies as negative controls. Blood and tumor samples were obtained from leukemia and lymphoma patients, screened by immunohistochemistry, and subjected to cell surface expression using analysis by FAScan, immunoprecipitation and analysis by Western blot analysis using selected antibodies. Screened. Detection of positive staining will then be an alternative procedure in improving the method of removal.
    [809] As one method, the multivariable regions of the positively stained antibodies previously selected are cloned and complement-fixed human isotypes express the structure. After subcloning and isotype switching, structure and reactivity are assessed as described above using, for example, FACS analysis, histology on normal tissues, immunoprecipitation methods and the like. Cassette vectors were created for the purpose of expressing selected multivariable regions within the human IgG1 structure. In addition, a series of primers were designed and synthesized to facilitate amplification of the multivariable region of the antibody of interest from hybridoma cell lines [Gavilondo-Cowley et al., In HYBRIDOMA, Vol 9 No; 5, 1990, Mary Anne Leibert Inc. Publishers, Media, PA, pp. 407-417]. The antibodies thus formed were then tested in vitro to determine if binding in the presence of complement results in cell death. In vitro assays are preferably performed using tumor cells. Control assays determine whether monoclonal antibodies exhibit the same activity in cell cultures that do not express α d .
    [810] Monoclonal antibodies are also tested to see if the binding results in internalization indicating that the antibody can be conjugated with a cytotoxic drug.
    [811] A latent model is prepared for investigating cytolytic activity in vivo. As an example, the equivalent is investigated in the F344 rat model (Example 26). Another model is the SCID / Hu system in which human cells have been transplanted. For example, myeloid U937 cells, Jurkat T cells or human colon carcinoma HTC166 cells, are transplanted into mice, tumors are recovered, and the tumors stained for surface antigens using anti-α d antibodies (eg, 212D and 217L). do. Detection of α d expression enables the removal of tumors using antibodies in vivo.
    [812] Example 44
    [813] Human anti-α dMonoclonal antibodies
    [814] Human monoclonal antibodies are identified by screening antibody reservoirs arranged on filamentous phage as is known [Waterhouse et al., Nucl. Acids Res. 21: 2265-2266 (1993); Parson et al., Protein Engineering 9: 1043-1049 (1996). In summary, functional V-gene segments from non-immunized human donors were used to construct reservoirs of single-chain Fv (scFv) fragments arranged on the phage surface. The fragments are cloned into phagemid vectors, which allow arrayed phage and soluble scFv to be produced without subcloning. The incorporation of histidine tags allows for the rapid purification of scFv by nickel chelate chromatography. This library format allows for the isolation of human monoclonal antibody fragments, usually within two weeks. Separation was performed as known [Marks et al., J. Mol. Biol. 222: 581-597 (1991), Vaughan et al., Nature Biotechnol. 14: 309-314 (1996). It is desirable to identify antibodies that specifically recognize the I domain.
    [815] Example 45
    [816] Anti-α in motheaten mice dAntibody treatment
    [817] Old mutant mice [Koo et al., J. Immunol. 147: 1194-1200 (1992); Koo et al., J. Immunol. 151: 673-6741 (1993), the autosomal recessive me v gene occurs spontaneously as a point mutation of the hematopoietic cell protein tyrosine phosphatase in C57BL / 6 mice. Homozygotes develop osteomyeloid inflammation, including the accumulation of bone marrow nuclei in the lungs and skin, leading to interstitial pneumonia, thymic hyperplasia and T cell and NK cell dysfunction. Inflammatory conditions can be transmitted by the bone marrow cells of these mice, suggesting that the me v mutation may be due to a defect of stem cells in the bone marrow pathway. Since α d is present in myeloid cells, a procedure for evaluating any inhibitory effect on immunopathological changes when treated with anti-α d monoclonal antibodies in normal mice transplanted with bone marrow from old mutant mice Was performed.
    [818] C57BL / 6J (B6) -me v / me v and their normal +/- brothers (B6)-+ /-mice were obtained from Jackson Laboratories, Bar Harbor, Ireland. The mice were fed in a sterile environment, freely fed with water and feed. All mice were 6-10 weeks old.
    [819] On day 1 all mice were intraperitoneally injected with 2 μg / ml α-NK1.1 antibody, PK136 (pamine) in 0.5 ml PBS. On day 0 all B6 +/− mice were irradiated with 750 Rad. Bone marrow was recovered from (B6) -me v / me v by known methods. Cells were removed from tibia and femur and placed in supplemented RPMI culture medium, incubated for 2 hours, and then injected intravenously into irradiated mice. Mice were immediately treated with intraperitoneal injection of 5 mg / kg of anti-α d antibody 205C or unrelated antibody in 200 μl PBS. Purified 205C hamster anti-rat α d monoclonal antibodies cross-reactive with mouse α d are as described above. As a negative control, one group of mice was injected with the same volume of saline. A total of 10 treatments were performed every 4 to 25 days every other day to treat mice with antibodies or saline and animals were monitored for changes in body weight and signs of disease. In general, observations were continued for each group for a total of two months.
    [820] The dying state is the end of the analysis. However, very sick animals were killed. Survival between groups was assessed and histological analysis of tissues was used as an additional indicator of the efficacy of α d antibody treatment. Similar experiments were conducted to investigate the therapeutic properties of α d antibodies to complement the prophylactic studies as described above.
    [821] None of the mice treated with the α d antibody at day 35 died, whereas two of the nine mice in the saline treatment group died and three of the remaining seven developed typical symptoms of the syndrome. In the group treated with unrelated antibodies, 3 of 8 died.
    [822] Example 46
    [823] Α in human leukemia dExpression of
    [824] Leukemia is classified into two types according to the cell line, that is, myeloid and lymphoid, and both types can be further classified as acute or chronic. Since α d expression is clearly limited to myeloid lineage cells, it is assumed that myeloid leukemia, not lymphoid, expresses α d . The second study is to estimate the disease-related function of α d on these cells by confirming that α d expression changes with pathogenesis if the first assumption is correct.
    [825] Expression of α d on peripheral blood cells was detected using antibodies 212D and 217L as described in Example 18. In the observation of leukemia cells, normal bone marrow cells were first analyzed for α d expression by flow cytometry to establish default values for these cell types. Patient samples were stained according to standard protocols using antibodies 212D and 217L, both antibodies showing weak reactivity with monocytes in the bone marrow. Only antibody 212D was positive at the edges.
    [826] Flow cytometry analysis of leukemia cells from the peripheral blood or bone marrow of the patient showed the presence of 212D and 217L epitopes on myeloid and monoblasts of three acute myeloid leukemia (AML) patients. Expression was also observed on cells from patients with chronic lymphocytic leukemia (CLL). Cells from other AML patients were evaluated after a few days and found to be α d positive. The expression of α d on cells was 50-100% more than the control monoclonal antibodies, but much less than the CD11a, CD11b and CD11c expression levels.
    [827] In view of these results, the U937 cell line, which is a myeloid lineage leukemia AML cell equivalent to step M-4 (at differentiation scale M1-M5), was also evaluated. Expression patterns of CD11a, CD11b, CD11c and α d were similar to those of AML patient cells. Interestingly, the presence of the cell surface α d protein depends on the culture conditions. Concentrated medium with high serum concentration (Iskov modified Dulbecco's medium, 20% FBS) supported α d expression, whereas basal culture medium (RPMI, 10% FBS) did not.
    [828] The discovery that α d expression is detected in lymphoblasts from CLL patients indicates that α d can be expressed in lymphocyte lineage cells and is consistent with other data (ie, α d expression on rat CD5 + cells and dog CD8 + cells). Indicates. The expression of other leucointegrins on these cells at relatively high levels hinders the use of these cells to investigate α d function in a reproducible manner, and the functional redundancy of these families compensates for the inhibition of one member of these cell types. Imply that Indeed, α d expression by these cells can occur simultaneously with abnormal transcription.
    [829] Although the above experiments do not fully support the initial assumptions, the presence of α d protein in myeloid and lymphoid leukemias benefited from anti-α d therapy in which various patient populations aimed at tumor elimination rather than inhibition of function. Imply that it can.
    [830] Many modifications and variations of the present invention as disclosed in the above examples are believed to be apparent to those skilled in the art. Accordingly, the invention is limited only by the appended claims.
    权利要求:
    Claims (12)
    [1" claim-type="Currently amended] A method of promoting recovery of motor skills after spinal cord injury, comprising administering to a spinal cord injury patient an effective amount of an anti-α d monoclonal antibody.
    [2" claim-type="Currently amended] The method of claim 1, wherein the ligand is selected from the group consisting of ICAM-R and VCAM-1.
    [3" claim-type="Currently amended] A method of inhibiting impairment in motor performance after spinal cord injury, comprising administering to a spinal cord injury patient an effective amount of an anti-α d monoclonal antibody.
    [4" claim-type="Currently amended] The method of claim 3, wherein the ligand is selected from the group consisting of ICAM-R and VCAM-1.
    [5" claim-type="Currently amended] A method of limiting impairment in motor performance after spinal cord injury, comprising administering to a spinal cord injury patient an effective amount of an anti-α d monoclonal antibody.
    [6" claim-type="Currently amended] The method of claim 5, wherein the ligand is selected from the group consisting of ICAM-R and VCAM-1.
    [7" claim-type="Currently amended] A method of limiting autonomic reflex insufficiency and sensory dysfunction following spinal cord injury comprising administering to a spinal cord injury patient an effective amount of an anti-α d monoclonal antibody.
    [8" claim-type="Currently amended] 8. The method of claim 7, wherein the ligand is selected from the group consisting of ICAM-R and VCAM-1.
    [9" claim-type="Currently amended] 9. The method of claim 1, wherein the anti-α d monoclonal antibody is secreted from a hybridoma selected from the group consisting of 217L or 226H. 10.
    [10" claim-type="Currently amended] The method of claim 1, wherein the anti-α d monoclonal antibody competes with 217L or 226H for binding to α d .
    [11" claim-type="Currently amended] 9. The method of claim 1, wherein the anti-α d monoclonal antibody inhibits α d binding to α d ligand. 10.
    [12" claim-type="Currently amended] The method of claim 1, wherein the spinal cord injury comprises spinal cord compression.
    类似技术:
    公开号 | 公开日 | 专利标题
    Spinardi et al.1995|A recombinant tail-less integrin beta 4 subunit disrupts hemidesmosomes, but does not suppress alpha 6 beta 4-mediated cell adhesion to laminins.
    Li et al.1993|Mouse Crry/p65. Characterization of monoclonal antibodies and the tissue distribution of a functional homologue of human MCP and DAF.
    Savinov et al.2003|Presentation of antigen by endothelial cells and chemoattraction are required for homing of insulin-specific CD8+ T cells
    AU766306B2|2003-10-16|Neutral amino acid transporter and gene thereof
    US7132255B2|2006-11-07|Identification of compounds that bind biliary glycoprotein and affect cytotoxic T lymphocyte activity
    Briskin et al.1996|Structural requirements for mucosal vascular addressin binding to its lymphocyte receptor alpha 4 beta 7. Common themes among integrin-Ig family interactions.
    DE69532279T2|2004-09-16|Methods and composition for inhibition of angiogenesis
    US7416849B2|2008-08-26|HBM variants that modulate bone mass and lipid levels
    DK1781698T3|2016-10-03|COMPOSITIONS AND METHODS FOR THE USE OF Angiopoietin-like-4-PROTEIN
    US7374872B2|2008-05-20|CC chemokine receptor 5 DNA, new animal models and therapeutic agents for HIV infection
    CN101287841B|2013-12-04|Anti-alpha|beta| antibodies and uses thereof
    Kato et al.2003|The contribution of glycoprotein VI to stable platelet adhesion and thrombus formation illustrated by targeted gene deletion
    Schmidt et al.2000|The biology of the receptor for advanced glycation end products and its ligands
    ES2632625T3|2017-09-14|Composition for use in the treatment of a disease
    US8137923B2|2012-03-20|Glycoprotein VI and uses thereof
    Shaw et al.1994|Molecular cloning of the human mucosal lymphocyte integrin alpha E subunit. Unusual structure and restricted RNA distribution.
    JP3837494B2|2006-10-25|Soluble RAGE protein
    JP4745872B2|2011-08-10|Ligands for receptors on the surface of activated CD4 + T cells |
    JP2013256535A|2013-12-26|Egfl7 antagonist-containing composition for modulating development of blood vessel, and method
    KR0169728B1|1999-01-15|Intercellular adhesion molecule-2
    CA2542171C|2015-12-15|Modulators and modulation of the interaction between rgm and neogenin
    US6737058B2|2004-05-18|Methods for inhibiting endothelial cell and fibrinogen mediated inflammation using fibrinogen specific antibodies
    US20130236889A1|2013-09-12|Vascularization Inhibitors
    Zhang et al.1996|E-selectin in focal cerebral ischemia and reperfusion in the rat
    Johnson-Léger et al.2002|Junctional adhesion molecule-2 | promotes lymphocyte transendothelial migration
    同族专利:
    公开号 | 公开日
    NZ525402A|2006-12-22|
    MXPA03003322A|2003-08-01|
    WO2002030980A3|2003-04-24|
    WO2002030980A2|2002-04-18|
    CN1589152A|2005-03-02|
    AU9683901A|2002-04-22|
    AU2001296839B2|2008-04-03|
    WO2002030980A8|2004-10-14|
    CA2425818A1|2002-04-18|
    US6432404B1|2002-08-13|
    JP2004532800A|2004-10-28|
    EP1325031A2|2003-07-09|
    CN100398152C|2008-07-02|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    2000-10-13|Priority to US09/688,307
    2000-10-13|Priority to US09/688,307
    2001-10-15|Application filed by 이코스 코포레이션
    2001-10-15|Priority to PCT/US2001/032059
    2003-06-02|Publication of KR20030044001A
    优先权:
    申请号 | 申请日 | 专利标题
    US09/688,307|2000-10-13|
    US09/688,307|US6432404B1|1993-12-23|2000-10-13|Methods of inhibiting locomotor damage following spinal cord injury with α D-specific antibodies|
    PCT/US2001/032059|WO2002030980A2|2000-10-13|2001-10-15|Use of anti-human integrin alpha d antibodies to treat spinal cord injury|
    [返回顶部]